Ontology highlight
ABSTRACT:
PROVIDER: PRJNA647992 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO
Project description:cecum contents from Arbor Acres broiler chicken Raw sequence reads
| PRJNA341571 | ENA
Project description:Background- Resistant starch is a prebiotic metabolized by the gut bacteria. It has been shown to attenuate chronic kidney disease (CKD) progression in rats. Previous studies employed taxonomic analysis using 16S rRNA sequencing and untargeted metabolomics profiling. Here we expand these studies by metaproteomics, gaining new insight into the host-microbiome interaction. Methods- Differences between cecum contents in CKD rats fed a diet containing resistant starch with those fed a diet containing digestible starch were examined by comparative metaproteomics analysis. Taxonomic information was obtained using unique protein sequences. Our methodology results in quantitative data covering both host and bacterial proteins. Results - 5,834 proteins were quantified, with 947 proteins originating from the host organism. Taxonomic information derived from metaproteomics data surpassed previous 16S RNA analysis, and reached species resolutions for moderately abundant taxonomic groups. In particular, the Ruminococcaceae family becomes well resolved – with butyrate producers and amylolytic species such as R. bromii clearly visible and significantly higher while fibrolytic species such as R. flavefaciens are significantly lower with resistant starch feeding. The observed changes in protein patterns are consistent with fiber-associated improvement in CKD phenotype. Several known host CKD-associated proteins and biomarkers of impaired kidney function were significantly reduced with resistant starch supplementation. Conclusions- Metaproteomics analysis of cecum contents of CKD rats with and without resistant starch supplementation reveals changes within gut microbiota at unprecedented resolution, providing both functional and taxonomic information. Proteins and organisms differentially abundant with RS supplementation point toward a shift from mucin degraders to butyrate producers.
2018-12-18 | PXD008845 | Pride
Project description:Metagenome of rat cecum, 16s amplicon study
| PRJEB33989 | ENA
Project description:3 genetic chicken lines (Leghorn G-B1, Fayoumi, broiler) were used. chicken were challenged with SE at day 1, spleen and cecum tissues were collected at 2 hours and 16 hours after post challenge Keywords: time-course
2006-04-23 | GSE2562 | GEO
Project description:16S rRNA amplicon sequencing of broiler caecal contents
| PRJEB33036 | ENA
Project description:3 genetic chicken lines (Leghorn G-B1, Fayoumi, broiler) were used. chicken were challenged with SE at day 1, spleen and cecum tissues were collected at 2 hours and 16 hours after post challenge
2010-06-11 | E-GEOD-2562 | biostudies-arrayexpress
Project description:The study critically evaluate the results of 16S targeted amplicon sequencing performed on the total DNA collected from healthy donors’ blood samples in the light of specific negative controls.
2024-03-01 | GSE254843 | GEO