Dataset Information

Covalent binding of enzymes in the ubiquitylation cascade as a response to oxidative stress

ABSTRACT: In contrast to the general ubiquitin activation and transfer cascade, we show that Uba1 binds to ubiquitin conjugating enzymes (Ubc) even in the absence of ubiquitin under mild oxidizing conditions. We show that this binding is ATP-dependent and leads to a disulfide-linkage between the catalytic cysteine residues as demonstrated with gel shift assays and visualized in a high-resolution structure of a covalent Uba1Ubc13 complex. The structure provides additional insights into the Uba1-Ubc binding mode and reveals unexpected structural changes in the N-terminus of Uba1, leading to a more open ATP-binding pocket. Immunoprecipitation experiments with yeast cells in combination with mass spectrometry revealed that several Uba~Ubc complexes are generated in vivo under oxidative stress conditions.

INSTRUMENT(S): LTQ Orbitrap Velos

ORGANISM(S): Saccharomyces Cerevisiae (baker's Yeast)

TISSUE(S): Tissue Not Applicable To Dataset

DISEASE(S): Not Available

SUBMITTER: Jens Vanselow

LAB HEAD: Andreas Schlosser

PROVIDER: PXD005588 | Pride | 2017-04-11

REPOSITORIES: Pride

ACCESS DATA

Dataset's files

Source:

			Action	DRS
	2016-11-11-velos_16302.raw	Raw
	2016-11-11-velos_16303.raw	Raw
	2016-11-11-velos_16304.raw	Raw
	2016-11-11-velos_16305.raw	Raw
	2016-11-11-velos_16306.raw	Raw

Items per page:

1 - 5 of 86

Publications

Proteomic identification of rainbow trout blood plasma proteins and their relationship to seminal plasma proteins.

Nynca Joanna J Arnold Georg G Fröhlich Thomas T Ciereszko Andrzej A

Proteomics 20170601 11

The characterisation of fish blood proteomes is important for comparative studies of seminal and blood proteins as well as for the analysis of fish immune mechanisms and pathways. In this study, LC-MS/MS and 2D-DIGE were applied to compare rainbow trout seminal (SP) and blood plasma (BP) proteomes. The 54 differentially abundant proteins identified in SP are involved in a variety of signalling pathways, including protein ubiquitination, liver X receptor/retinoid X receptor (LXR/RXR) and farnesoi ...[more]

PMID: 28394474

Similar Datasets

Project description:The small RNAs presented here were produced as a preliminary exploration of small RNAs in rice, and as such, various tissues and stress conditions were sampled. Small RNAs present in these samples were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. The datasets contain Oryza sativa var Nipponbar endogenous small RNA sequences in the size range 18 to 34 nt. Plants were grown in a Conviron Environmental Chamber at high light intensity using both high pressure sodium and metal halide lamps for 10.5 hr at 28 degrees C and for 13.5 hr at 26 degrees C in the dark. RNA was extracted from rice tissues at various stages of development and under different abiotic and biotic stresses. The small RNAs presented here were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. Run 1: A small RNA library was generated from whole cell RNA isolated from inflorescence, 30 and 60 day leaves, 10 and 25 day seedlings and from seedling polysomes using Bartel primers (5' ATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAAT 3'). This was combined with a library derived from whole cell RNA isolated from 30 and 60 day leaves and 10 and 25 day seedlings using Bartel A primers (5' AGCTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATACTG 3'). Run 2: Mixed tissues from unstressed plants. Library prepared from equal amounts of adult root, adult stem and inflorescence from unstressed plants. Amplified with Standard primers (5' ATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAAT 3'). Seedlings stressed by cold, salt desiccation, heat and dark. Tissues were mixed in a 2:2:1:1:1:1 ratio. Amplified with A primers (5' AGCTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATACTG 3'). Kinase library. RNA was isolated from tissues used in 'Adult whole plant' (~30%), 'Stressed' (~25%), from unstressed seedlings of various ages (~15%) from 30 and 60 day leaves (20%) and from immature inflorescence (~10%). RNA isolated from tissues from unstressed plants were treated with polynucleotide kinase before second ligation. This eliminates the dependence of a 5` phosphate as for all the other libraries. Amplified with B primers (5' CAGTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATAGCT 3').