Browse
Submit Data
Databases
API
Help

Dataset Information

241 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

DDX3X interactome - The helicase, DDX3X, interacts with poly(A)-binding protein 1 (PABP1) and caprin-1 at the leading edge of migrating fibroblasts and is required for efficient cell spreading

ABSTRACT: As DDX3X can regulate Rac1 levels, cell motility and metastasis, we have examined DDX3X protein interactions and localisation using a number of complementary approaches.

INSTRUMENT(S): Q Exactive

ORGANISM(S): Homo Sapiens (human)

TISSUE(S): Cell Culture, Fibroblast

SUBMITTER: Alice Copsey

LAB HEAD: Prof. Simon Morley

PROVIDER: PXD006497 | Pride | 2018-10-24

REPOSITORIES: Pride

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	C1.raw	Raw
	C1_B.raw	Raw
	C2.raw	Raw
	C2_B.raw	Raw
	DDXC_H.raw	Raw

Items per page:

1 - 5 of 11

Publications

The helicase, DDX3X, interacts with poly(A)-binding protein 1 (PABP1) and caprin-1 at the leading edge of migrating fibroblasts and is required for efficient cell spreading.

Copsey Alice C AC Cooper Simon S Parker Robert R Lineham Ella E Lapworth Cuzack C Jallad Deema D Sweet Steve S Morley Simon J SJ

The Biochemical journal 20170830 18

DDX3X, a helicase, can interact directly with mRNA and translation initiation factors, regulating the selective translation of mRNAs that contain a structured 5' untranslated region. This activity modulates the expression of mRNAs controlling cell cycle progression and mRNAs regulating actin dynamics, contributing to cell adhesion and motility. Previously, we have shown that ribosomes and translation initiation factors localise to the leading edge of migrating fibroblasts in loci enriched with a ...[more]

PMID: 28733330

Similar Datasets

RNA Helicase DDX3X Modulates Herpes Simplex Virus 1 Nuclear Egress

Project description:DDX3X is a mammalian RNA helicase that regulates RNA metabolism, cancers, innate immunity and several RNA viruses. We discovered that herpes simplex virus 1, a nuclear DNA replicating virus, highjacks redirects DDX3X to the nuclear envelope where it surprisingly modulates the exit of newly assembled viral particles. DDX3X depletion also led to an accumulation of virions in intranuclear herniations. Mechanistically, we show that DDX3X physically and functionally interacts with the virally encoded nuclear egress complex at the inner nuclear membrane. DDX3X also bound to and stimulated the incorporation in mature particles of pUs3, a herpes kinase that promotes viral nuclear release across the outer nuclear membrane. Overall, the data highlights two unexpected roles for an RNA helicase during the passage of herpes simplex viral particles through the nuclear envelope. This reveals a highly complex interaction between DDX3X and viruses and provides new opportunities to target viral propagation.

2023-02-21 | PXD039403 | Pride

Ubiquitination of DEAD-box RNA helicase DDX3X by TRIM25

Project description:Tripartite motif protein 25 (TRIM25) is an E3 ligase that ubiquitinates multiple substrates within the RLR signalling cascade and plays both RING (really interesting new gene)-dependent and RING-independent roles in RIG-I-mediated IFN induction. We report that the PRY-SPRY domain of TRIM25 interacts with the N-terminal extension (NTE) of DEAD-box helicase 3X (DDX3X), a host protein with multiple roles in RLR signalling. Gene reporter assays and knockdown studies reveal DDX3X and TRIM25 cooperate to activate the IFN- promoter following RIG-I activation independent of DDX3X’s catalytic activity. We also show that TRIM25 ubiquitinates DDX3X at several lysine residues in vitro and in cells.

2021-09-08 | PXD028122 | Pride

The X-linked DDX3X RNA helicase dictates translation re-programming and metastasis in melanoma

Project description:The X-linked DDX3X gene encodes an ATP-dependent DEAD-box RNA helicase frequently altered in various human cancers including melanomas. Despite its important roles in translation and splicing, how DDX3X dysfunction specifically rewires gene expression in melanoma remains completely unknown. Here we uncover a DDX3X-driven post-transcriptional program that dictates melanoma phenotype and poor disease prognosis. Through an unbiased analysis of translating ribosomes we identified the microphtalmia-associated transcription factor, MITF, as a key DDX3X translational target that directs a proliferative-to-metastatic phenotypic switch in melanoma cells. Mechanistically, DDX3X controls MITF mRNA translation via an internal ribosome entry site (IRES) embedded within the 5’ untranslated region. Through this exquisite translation-based regulatory mechanism, DDX3X steers MITF protein levels dictating melanoma metastatic potential in vivo and response to targeted therapy. Together these findings unravel a post-transcriptional layer of gene regulation that may provide a unique therapeutic vulnerability in aggressive male melanomas.

2019-05-17 | GSE131343 | GEO

Medulloblastoma associated DDX3X mutants restore malignant potential of medulloblastoma cells decreased upon the loss of DDX3X expression

Project description:DDX3X is an ATP-dependent RNA helicase. Missense mutations in DDX3X gene are known to occur in WNT, SHH subgroup medulloblastomas. The role of DDX3X in medulloblastoma biology was studied by downregulating its expression in a SHH subgroup Daoy medulloblastoma cell line. DDX3X knockdown resulted in considerable reduction in proliferation, clonogenic potential and anchorage-independent growth of the medulloblastoma cells. Transcriptome analysis was performed to delineate the molecular mechanism underlying reduction in the malignant potential of the medulloblastoma cells upon DDX3X knockdown. Exogenous expression of three DDX3X missense mutants in the DDX3X knockdown cells could restore the malignant potential of the medulloblastoma cells.

2023-03-31 | GSE201967 | GEO

Transcriptome analysis of Listeria monocytogenes infected bone marrow derived macrophages with or without DEAD-box helicase DDX3X

Project description:Bone marrow derived macrophages were infected with Listeria monocytogenes for 4 hours. We investigated differently expressed genes in the absence of DDX3X upon infection and also in steady state conditions.

2018-10-17 | GSE86591 | GEO

Transcriptome profiling of DDX3X/DDX3Y dependency after DDX3X gRNA targeting in KNS-42 parental cell lines, and rescue experiments with DDX3X or DDX3Y overexpressing cells (PACT).

Project description:Paralog dependency analysis of the DDX3X/DDX3Y genes through RNA-seq. Three types of KNS-42 cell lines are used in this experiment: one parental, one with a DDX3X over-expression (codon optimized) and one with DDX3Y over-expression (codon optimized). Targeting of the DDX3X gene is performed with guide RNAs 395 (TGGTACATGCGTATCCTTCA). The negative control is targeting AAVS1/PPP1R12C (AAVS1, GGGGCCACTAGGGACAGGAT). Samples were processed at 7 days after transduction. 3 independent repeats of the experiment were performed.

2022-04-06 | GSE190507 | GEO

DDX3X regulation of global translation is impaired by medulloblastoma-associated mutations [RiboSeq]

Project description:Whole-genome sequencing recently identified recurrent missense mutations in the RNA helicase DDX3X in pediatric medulloblastoma (MB) and other tumors. The normal function of DDX3X is poorly understood, and the consequences of its cancer-associated mutations have not been explored. Here we used genomic, biochemical, cell biological, and animal modeling approaches to investigate normal DDX3X function and the impact of cancer-associated DDX3X mutations. Cross-linking immunoprecipitation–high-throughput sequencing (CLIPseq) analyses revealed that DDX3X binds primarily to ~1000 mature mRNA targets at binding sites spanning the full mRNA length; their enrichment in the coding regions suggests that DDX3X plays a role in translational elongation. The association of wild-type DDX3X with polysomes is consistent with this observation. Cancer-associated mutations result in loss of DDX3X from polysomes and accumulation of mutant DDX3X in stress granules (cytoplasmic accumulations of translationally arrested mRNAs). Mutation-dependent redistribution of DDX3X to stress granules is also observed in a Drosophila model system and in MB tumor cells from patients carrying DDX3X mutations. Importantly, mRNAs targeted by DDX3X are enriched in translation factors, suggesting that DDX3X regulates translation both directly and indirectly. Indeed, depletion of DDX3X by RNAi or over-expression of mutant DDX3X significantly impairs global protein synthesis. Ribosome profiling confirmed this observation and showed a 5’ bias in ribosomal occupancy, further confirming the role of DDX3X in translational elongation. Together, our data show that DDX3X is a key regulator of translation and that this function is impaired by cancer-associated mutations. Finally, we found that medulloblastoma-related mutant DDX3X can efficiently bind the wild-type form suggesting that mutant DDX3X could exert a dominant negative effect in vivo.

2016-05-20 | GSE59095 | GEO

DDX3X suppresses neural lineage susceptibility to medulloblastoma [DNA-Seq]

Project description:DDX3X is frequently mutated in the WNT and SHH subtypes of medulloblastoma Ð the commonest malignant childhood brain tumor. But whether DDX3X functions as a medulloblastoma oncogene or tumor suppressor gene is not known. Here we show that Ddx3x regulates hindbrain patterning and development by controlling Hox gene expression and cell stress signaling. In mice predisposed to Wnt or Shh-medulloblastoma Ddx3x sensed oncogenic stress and suppressed tumor formation. WNT and SHH-medulloblastomas normally arise only in the lower and upper rhombic lips respectively. Deletion of Ddx3x relived this lineage restriction enabling both medulloblastoma subtypes to arise in either germinal zone. Thus DDX3X is a medulloblastoma tumor suppressor that regulates hindbrain development and restricts the competence of cell lineages to form medulloblastoma subtypes.

2020-03-19 | GSE147069 | GEO

DDX3X suppresses neural lineage susceptibility to medulloblastoma [RNA-seq]

2020-03-19 | GSE147178 | GEO

DDX3X regulation of global translation is impaired by medulloblastoma-associated mutations [CLIP-Seq]

2016-05-20 | GSE59094 | GEO