Dataset Information

Complementary proteomics strategies identify the ataxin-1 interactome in Neuro-2a cells

ABSTRACT: To identify protein partners of ataxin-1 in neuronal cells under control or stress conditions, we use complementary proteomics strategies of proximity-dependent biotin identification (BioID) and affinity purification (via GFP-trap pulldown) in Neuro-2a cells expressing epitope-tagged forms of ataxin-1[85Q]. These approaches allowed our enrichment of proximal proteins and interacting partners, respectively, with the subsequent protein identification performed by liquid chromatography-MS/MS. Background proteins, defined by identification not dependent on the polyQ-ataxin-1 protein, were additionally identified by their endogenous biotinylation (for the BioID protocol) or by their non-specific interaction with GFP only (in the GFP-trap protocol). All datasets were generated from biological replicates.

INSTRUMENT(S): Q Exactive

ORGANISM(S): Mus Musculus (mouse)

TISSUE(S): Permanent Cell Line Cell

SUBMITTER: Sunyuan Zhang

LAB HEAD: Marie A. Bogoyevitch

PROVIDER: PXD010352 | Pride | 2018-10-18

REPOSITORIES: pride

ACCESS DATA

Dataset's files

Source:

			Action	DRS
	BioID1_151105_85QAs_F069353.mzid.xml	Mzid
	BioID1_151105_85Q_F069355.mzid.xml	Mzid
	BioID1_151105_NT_F069359.mzid.xml	Mzid
	BioID1_151105_Sunyuan_85Q.mgf	Mgf
	BioID1_151105_Sunyuan_85Q.raw	Raw

Items per page:

1 - 5 of 63

Publications

Complementary proteomics strategies capture an ataxin-1 interactome in Neuro-2a cells.

Zhang Sunyuan S Williamson Nicholas A NA Bogoyevitch Marie A MA

Scientific data 20181120

Ataxin-1 mutation, arising from a polyglutamine (polyQ) tract expansion, is the underlying genetic cause of the late-onset neurodegenerative disease Spinocerebellar ataxia type 1 (SCA1). To identify protein partners of polyQ-ataxin-1 in neuronal cells under control or stress conditions, here we report our complementary proteomics strategies of proximity-dependent biotin identification (BioID) and affinity purification (via GFP-Trap pulldown) in Neuro-2a cells expressing epitope-tagged forms of a ...[more]

PMID: 30457570

Publication: 1/2

Similar Datasets

Project description:During murine hypothalamic development, different neuroendocrine cell phenotypes are generated in overlapping periods; this suggests that cell-type specific developmental programs operate to achieve complete maturation. A balance between programs that include cell proliferation, cell cycle withdrawal as well as epigenetic regulation of gene expression characterizes neurogenesis. Thyrotropin releasing hormone (TRH) is a peptide that regulates energy homeostasis and autonomic responses. To better understand the molecular mechanisms underlying TRH neuron development, we performed a genome wide study of its transcriptome during fetal hypothalamic development. In primary cultures, TRH cells constitute 2% of the total fetal hypothalamic cell population. To purify these cells, we took advantage of the fact that the segment spanning –774 to +84 bp of the Trh gene regulatory region confers specific expression of the green fluorescent protein (GFP) in the TRH cells. Transfected TRH cells were purified by fluorescence activated cell sorting, various cell preparations pooled, and their transcriptome compared to that of GFP- hypothalamic cells. TRH cells undergoing the terminal phase of differentiation, expressed genes implicated in protein biosynthesis, intracellular signaling and transcriptional control. Among the transcription-associated transcripts, we identified the transcription factors Klf4, Klf10 and Atf3, which were previously uncharacterized within the hypothalamus. To our knowledge, this is the first report identifying transcripts with a potentially important role during the development of a specific hypothalamic neuronal phenotype. This genome-scale study forms a rational foundation for identifying genes that might participate in the development and function of hypothalamic TRH neurons. Hypothalamic primary cultures were prepared from E17 rat embryos. Twenty-four hours after seeding, cells were transfected using the minimal Trh promoter (-776/+84 bp) upstream of the GFP. Forty-eight hours after transfection, cells were trypsinized and subjected to FACS. TRH+ cells were purified from a pool of five 60-mm dishes using the FACS Vantage (Becton Dickinson, San Jose, CA) and the exclusion method at high speed (60 µl/min). In general, 20,000 GFP+ cells were purified from 5 X 106 cells. The microarray analysis was performed as described in the Affymetrix expression analysis technical manual (http://www.affymetrix.com). Total RNA (10 µg) was extracted from three different cell populations: i) sorted TRH-GFP+ cells (GFP+); ii) TRH-GFP+ and GFP- mixed cells (GFP+/-) passed through the FACS but not sorted, and iii) non transfected cells (NT). To obtain a sufficient amount of RNA for each cell population, the number of independent experiments pooled for the GFP+ sample was higher than for the other samples. Therefore, a pool of six independent experiments was used to prepare total RNA from the GFP+ and three independent experiments for GFP+/- or NT cells.

Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome