Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Chemical genetics strategy to profile kinase target engagement reveals role of FES in neutrophil phagocytosis via SYK activation

ABSTRACT: Identification of covalently bound protein targets of probe WEL028 in wild-type or mutant HL-60 cells.

INSTRUMENT(S): Synapt MS

ORGANISM(S): Homo Sapiens (human)

TISSUE(S): Cell Culture

SUBMITTER: Tom van der Wel

LAB HEAD: Mario van der Stelt

PROVIDER: PXD018270 | Pride | 2020-05-25

REPOSITORIES: Pride

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	20171231_WEL_01.zip.raw	Raw
	20171231_WEL_02.zip.raw	Raw
	20171231_WEL_03.zip.raw	Raw
	20171231_WEL_07.zip.raw	Raw
	20171231_WEL_08.zip.raw	Raw

Items per page:

1 - 5 of 29

Publications

Chemical genetics strategy to profile kinase target engagement reveals role of FES in neutrophil phagocytosis.

van der Wel Tom T Hilhorst Riet R den Dulk Hans H van den Hooven Tim T Prins Nienke M NM Wijnakker Joost A P M JAPM Florea Bogdan I BI Lenselink Eelke B EB van Westen Gerard J P GJP Ruijtenbeek Rob R Overkleeft Herman S HS Kaptein Allard A Barf Tjeerd T van der Stelt Mario M

Nature communications 20200625 1

Chemical tools to monitor drug-target engagement of endogenously expressed protein kinases are highly desirable for preclinical target validation in drug discovery. Here, we describe a chemical genetics strategy to selectively study target engagement of endogenous kinases. By substituting a serine residue into cysteine at the DFG-1 position in the ATP-binding pocket, we sensitize the non-receptor tyrosine kinase FES towards covalent labeling by a complementary fluorescent chemical probe. This mu ...[more]

PMID: 32587248

Similar Datasets

Chemical genetics strategy to profile kinase target engagement reveals role of FES in neutrophil phagocytosis via SYK activation

Project description:Comparative transcriptome profiling reveals that wild-type and CRISPR/Cas9-engineered FES_S700C HL-60 cells have highly similar transcript levels.

2020-05-25 | GSE145811 | GEO

Chemical genetics strategy to profile kinase target engagement reveals role of FES in neutrophil phagocytosis.

Project description:Chemical tools to monitor drug-target engagement of endogenously expressed protein kinases are highly desirable for preclinical target validation in drug discovery. Here, we describe a chemical genetics strategy to selectively study target engagement of endogenous kinases. By substituting a serine residue into cysteine at the DFG-1 position in the ATP-binding pocket, we sensitize the non-receptor tyrosine kinase FES towards covalent labeling by a complementary fluorescent chemical probe. This mutation is introduced in the endogenous FES gene of HL-60 cells using CRISPR/Cas9 gene editing. Leveraging the temporal and acute control offered by our strategy, we show that FES activity is dispensable for differentiation of HL-60 cells towards macrophages. Instead, FES plays a key role in neutrophil phagocytosis via SYK kinase activation. This chemical genetics strategy holds promise as a target validation method for kinases.

| S-EPMC7316778 | biostudies-literature

Exocytic events in neutrophil-mediated inflammation.

Project description:The purpose of the present study was to elucidate the exocytic events in neutrophil-mediated inflammation. Therefore, we first investigated the expression of genes implicated in these exocytic events in a cell model for neutrophils, the promyelocytic HL-60 cell line. By the addition of 1.3% DMSO during 4.5 days, these cells are differentiated into neutrophil-like dHL-60 cells. Non-differentiated cells served as control. Upon cell differentiation, we i) identified differentially expressed genes implicated in the mechanisms of vesicle transport, and ii) found some of them being upregulated. This upregulated gene expression upon DMSO-maturation points towards a functional role in these cells. Secondly, we confirmed the expression of the selected genes in human neutrophils, isolated from venous blood of 4 different donors.

2014-11-25 | E-MTAB-2107 | biostudies-arrayexpress

Neutrophil-derived pro-inflammatory cytokine response and degranulation in function of time and dose of LPS treatment.

Project description:The purpose of the present study was to elucidate in more details the molecular mechanisms of neutrophil-mediated inflammation. We therefore investigated the time-dependent stimulatory potential of LPS from Escherichia coli on cytokine response in neutrophil-like HL-60 cells. <br><br>To get a general overview on the total mRNA changes in DMSO-differentiated HL-60 cells, we performed whole-transcript analysis of LPS-stimulated dHL-60 cells after 2h and 6h of LPS treatment. The samples were collected from three independent experiments from three different passages in cell culture. Non-stimulated dHL-60 cells served as control. We identified the differentially expressed cytokine genes implicated in the human inflammatory response and prominent for their role in neutrophil-mediated inflammatory processes.

2014-12-17 | E-MTAB-1393 | biostudies-arrayexpress

SYK Is a Critical Regulator of FLT3 In Acute Myeloid Leukemia

Project description:Cooperative dependencies between mutant oncoproteins and wild-type proteins are critical in cancer pathogenesis and therapy resistance. Although spleen tyrosine kinase (SYK) has been implicated in hematologic malignancies, it is rarely mutated. We used kinase activity profiling to identify collaborators of SYK in acute myeloid leukemia (AML) and determined that FMS-like tyrosine kinase 3 (FLT3) is transactivated by SYK via direct binding. Highly activated SYK is predominantly found in FLT3-ITD positive AML and cooperates with FLT3-ITD to activate MYC transcriptional programs. FLT3-ITD AML cells are more vulnerable to SYK suppression than FLT3 wild-type counterparts. In a FLT3-ITD in vivo model, SYK is indispensable for myeloproliferative disease (MPD) development, and SYK overexpression promotes overt transformation to AML and resistance to FLT3-ITD-targeted therapy. HL-60, MOLM-14, and U937 cell lines were transduced in triplicate with a control luciferase-directed shRNA (target sequence CCTAAGGTTAAGTCGCCCTCG), and in duplicate with two SYK-directed shRNAs: shSYK_1 (clone ID TRCN0000197257, target sequence GCAGCAGAACAGACATGTCAA) and shSYK_2 (clone ID TRCN0000003163 , target sequence GCAGGCCATCATCAGTCAGAA), and were then selected with 1 Âµg/ml puromycin 48 hours post-infection. At day 5 post-infection, RNA was extracted and profiled using HT HG-U133A arrays (Affymetrix) at the Broad Institute (Cambridge, MA, USA). The computational analysis of the gene expression data was performed through the Genome Space bioinformatics platform (http://www.genomespace.org).

2014-01-15 | E-GEOD-54065 | biostudies-arrayexpress

Chemical genetics strategy to profile kinase target engagement reveals role of FES in neutrophil phagocytosis via SYK activation

Project description:Chemical genetics strategy to profile kinase target engagement reveals role of FES in neutrophil phagocytosis via SYK activation

| PRJNA608435 | ENA

RNA-seq analysis of neutrophils from CD40L-deficient patients and healthy controls, as well as HL-60 promielocytic cell line

Project description:We aim to characterize to effects of the absence of CD40L on neutrophil transcriptome and the effect of soluble CD40L on HL60 cells. For this purpose Total RNA of isolated neutrophils from three CD40L-deficient patients and three healthy controls as well as HL-60 cells from ATCC (HL-60 (ATCC CCL-240) were analyzed by RNAseq. Before RNA obtention, neutrophils were incubated for 2 hours in the presence or absence of 100 U/ml rhIFN- (Immukine, Boehringer Ingelheim), and HL-60 cells cultured for 6 days in the presence or absence of 500 ng/mL sCD40L and/or 1,0 % dimethyl sulfoxide (DMSO).

2017-03-14 | E-MTAB-5316 | biostudies-arrayexpress

Cardiac transcription factors in HL-1 cells: gene expression and genome binding profiling

Project description:[1] Gene expression profiling in Gata4, Mef2a knockdown in HL-1 cells. HL-1 cells infected with adenovirus expressing either control siRNA or Gata4, and Gata4 & Mef2a siRNA. [2] Genome-wide maps of cardiac transcription factors binding region in HL-1 cells. We performed bio-ChIP-seq using streptavidin beads immunoprecipitation of biotinylated 5 cardiac transcription factors (fbio) and P300 antibody ChIP-seq. We used a dox-inducible dual adenovirus system to express biotinylated Core Cardiac TFs in HL1. One adenovirus expressed the dox-activated reverse tet activator protein (rtTA) and the E. coli biotinylating enzyme BirA from the cardiac specific rat troponin T promoter. The second virus expressed a Core Cardiac TF fused to a C-terminal flag-bio epitope tag, where bio is the 15 amino acid substrate for BirA. This in vivo biotinylation approach permits pulldown of different factors to be performed under identical, stringent conditions, and circumvents limitations posed by available antibodies. We titrated adenovirus and dox doses to express GATA4flbio and MEF2Aflbio at near endogenous levels. The same conditions were then used to express SRFflbio, TBX5flbio, and NKX2-5flbio. Reference: 12. de Boer E, Rodriguez P, Bonte E, Krijgsveld J, Katsantoni E et al. (2003) Efficient biotinylation and single-step purification of tagged transcription factors in mammalian cells and transgenic mice. Proc Natl Acad Sci U S A 100: 7480-7485. [1] Gene expression profiling: Identify differentially expressed genes after siRNA Gata4 or Gata4_Mef2a double knockdown in HL-1 cells [2] Genome occupancy profiling: Identify cardiac active enhancers by identified 5 cardiac transcription factors and P300 peaks.

2011-03-02 | E-GEOD-21529 | biostudies-arrayexpress

Transcription profiling of human HL-60 leukemia cells after treatment with Curcumin and TCDD

Project description:Curcumin has antileukemic potential that is mediated by dfifferent pathways. Because we could not confirm that the Arylhydrocarbonreceptor, a ligand activated transcription factor, is involved in curcumins antileukemic effects, we performed microarray experiments to have an overall screening of the pathways affected by curcumin in HL-60 cells. We identified an involvement of the vitamin D receptor in the effects of curcumin on HL-60 cells by comparing our results with other experiments. Experiment Overall Design: HL-60 cells were treated for 24h with 100 ÂµM curcumin, 10 nM 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), or 0.5 % DMSO as control.

2009-06-01 | E-GEOD-16160 | biostudies-arrayexpress

Human HL-60 Cells: all-trans retinoic acid (ATRA) vs. ATRA plus arsenic trioxide (ATO)

Project description:Transcriptional profiling of human leukemia?HL-60 cells comparing ATRA treated HL-60 cells with ATRA plus ATO. Goal was to determine the effects of ATO on ATRA induced differentiation of HL-60 cells. Two-condition experiment, ATRA vs. ATRA plus ATO treated HL-60 cells.

2015-03-31 | E-GEOD-67420 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data