Dataset Information

Analysis of protein-DNA interactions in chromatin by UV induced cross-linking and mass spectrometry

ABSTRACT: Protein–DNA interactions are key to the functionality and stability of the genome. Identification and mapping of protein–DNA interaction interfaces and sites is crucial for understanding DNA-dependent processes. Here, we present a workflow that allows mass spectrometric (MS) identification of proteins in direct contact with DNA in reconstituted and native chromatin after cross-linking by UV light. Our approach enables the determination of contact interfaces at amino-acid level. With the example of chromatin-associated protein SCML2 we show that our technique allows differentiation of nucleosome-binding interfaces in distinct states. By UV cross-linking of isolated nuclei we determined the cross-linking sites of several factors including chromatin-modifying enzymes, demonstrating that our workflow is not restricted to reconstituted materials. As our approach can distinguish between protein–RNA and DNA interactions in one single experiment, we project that it will be possible to obtain completely new insights into chromatin and its regulation in the future.

INSTRUMENT(S): Q Exactive HF, Q Exactive

ORGANISM(S): Homo Sapiens (human) Xenopus Laevis (african Clawed Frog)

TISSUE(S): Hela Cell

SUBMITTER: Luisa Welp

LAB HEAD: Henning Urlaub

PROVIDER: PXD020290 | Pride | 2020-10-20

REPOSITORIES: Pride

ACCESS DATA

Dataset's files

Source:

			Action	DRS
	AStuetzer_100118_120118_HeLaUV_rep1_TiO2_sample1_RNPxlsettings2.idxml	Other
	AStuetzer_100118_120118_HeLaUV_rep1_TiO2_sample2_RNPxlsettings2.idxml	Other
	AStuetzer_100118_120118_HeLaUV_rep1_sample1.mzML	Mzml
	AStuetzer_100118_120118_HeLaUV_rep1_sample1_DNAsearch.idXML	Other
	AStuetzer_100118_120118_HeLaUV_rep1_sample1_RNAsearch.idXML	Other

Items per page:

1 - 5 of 82

Publications

Analysis of protein-DNA interactions in chromatin by UV induced cross-linking and mass spectrometry.

Stützer Alexandra A Welp Luisa M LM Raabe Monika M Sachsenberg Timo T Kappert Christin C Wulf Alexander A Lau Andy M AM David Stefan-Sebastian SS Chernev Aleksandar A Kramer Katharina K Politis Argyris A Kohlbacher Oliver O Fischle Wolfgang W Urlaub Henning H

Nature communications 20201016 1

Protein-DNA interactions are key to the functionality and stability of the genome. Identification and mapping of protein-DNA interaction interfaces and sites is crucial for understanding DNA-dependent processes. Here, we present a workflow that allows mass spectrometric (MS) identification of proteins in direct contact with DNA in reconstituted and native chromatin after cross-linking by ultraviolet (UV) light. Our approach enables the determination of contact interfaces at amino-acid level. Wit ...[more]

PMID: 33067435

Similar Datasets

Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome