Dataset Information

ChIP-MS reveals the local chromatin composition by label-free quantitative proteomics

ABSTRACT: Chromatin immunoprecipitation (ChIP) has been a cornerstone for epigenetic analyses over the last decades, but even coupled to sequencing approaches (ChIP-seq), it is ultimately limited to one protein at a time. In a complementary effort, we here combined ChIP with label-free quantitative (LFQ) mass spectrometry (ChIP-MS) to interrogate local chromatin compositions. We demonstrate the versality of our approach at telomeres, with transcription factors, in tissue and by dCas9-driven locus-specific enrichment.

INSTRUMENT(S): Q Exactive HF, timsTOF fleX

ORGANISM(S): Homo Sapiens (human) Mus Musculus (mouse)

TISSUE(S): Liver, U2-os Cell, Jurkat Cell

SUBMITTER: Dennis Kappei

LAB HEAD: Dennis Kappei

PROVIDER: PXD039627 | Pride | 2024-03-05

REPOSITORIES: Pride

ACCESS DATA

Dataset's files

Source:

			Action	DRS
	20180802_LAB_WK_U2OS_DSPFA_LFQ1_ChIP_IGG_01.raw	Raw
	20180802_LAB_WK_U2OS_DSPFA_LFQ1_ChIP_IGG_02.raw	Raw
	20180802_LAB_WK_U2OS_DSPFA_LFQ1_ChIP_IGG_03.raw	Raw
	20180802_LAB_WK_U2OS_DSPFA_LFQ1_ChIP_IGG_04.raw	Raw
	20180802_LAB_WK_U2OS_DSPFA_LFQ1_ChIP_TRF2_01.raw	Raw

Items per page:

1 - 5 of 288

Similar Datasets

Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome

Project description:The centromere is defined by the presence of a centromere-specific histone H3 variant, CENH3. Establishment and maintenance of the centromeric chromatin (CEN chromatin) is determined by poorly understood epigenetic mechanisms. Interestingly, CEN chromatin in several eukaryotes showed euchromatic characteristics although being embedded within pericentromeric heterochromatin. Specifically, H3K4me2 appeared to be a unique histone modification mark associated with animal centromeres. We developed a genomic tiling array for four fully sequenced rice centromeres. A ChIP-chip approach was used to study the patterns of several euchromatic histone modification marks, including H3K4me2, H3K4me3, H3K36me3, and H3K4K9a, associated with rice centromeres. We demonstrate that the CENH3 subdomains within the four centromeres are depleted with the four histone H3 marks. The vast majority of the four histone marks were associated with the genes located in the H3 subdomains within the centromeric cores. Genes in the centromeres showed similar histone modification patterns as those located outside of the centromeres. Thus, the euchromatic characteristics of rice CEN chromatin are trademarks of the transcribed sequences embedded in the H3 subdomains of the centromeres. We propose that the constitutively expressed genes located in rice centromeres may provide a barrier for loading of CENH3 into the H3 subdomains. The separation of CENH3 into the H3 subdomains is favorable for the three dimensional structure and its associated function of rice centromeres. We developed a genomic tiling array that covers four rice centromeres (Cen4, Cen5, Cen7, and Cen8) using the NimbleGen 3x720K array based on the NimbleGen HD2 platform. We used four antibodies (H3K4me3, H3K4me2, H3K36me3, H3K4K9ac) to perform ChIP-chip experiments. ChIP was conducted using leaf tissue from two-week old rice seedlings. We have 3 biological replicates for each antibody and 6 technological replicates of hybridization with position exchange on the array. Thus, each histone modification included 18 hybridization experiments.

Dataset Information

ChIP-MS reveals the local chromatin composition by label-free quantitative proteomics

Dataset's files

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets