CRISPR Display: A modular method for locus-specific targeting of long noncoding RNAs and synthetic RNA devices in vivo
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
SUBMITTER: Scott Younger
PROVIDER: E-GEOD-66756 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:Noncoding RNAs (ncRNAs) comprise an important class of natural regulators that mediate a vast array of biological processes, including the modulation of chromatin architecture. Moreover, artificial ncRNAs have revealed that the functional capabilities of RNA are extremely broad. To further investigate and harness these capabilities, we developed CRISPR-Display ("CRISP-Disp"), a targeted localization strategy that uses Cas9 to deploy large RNA cargos to specific DNA loci. We demonstrate that exogenous RNA domains can be functionally appended onto the CRISPR scaffold at multiple insertion points, allowing the construction of Cas9 complexes with RNAs nearing one kilobase in length, with structured RNAs, protein-binding cassettes, artificial aptamers and pools of random sequences. CRISP-Disp also allows the simultaneous multiplexing of disparate functions at multiple targets. We anticipate that this technology will provide a powerful method with which to ectopically localize functional RNAs and ribonuceloprotein complexes at specified genomic loci. Whole cell poly(A) selected RNA seq, from HEK293FT cells bearing lentivirally-integrated Gaussia and Cypridina luciferase reporter loci. Cells were transiently transfected with dCas9~VP64 alone, or with dCas9~VP and one of several modified sgRNAs,each targeting the Gaussia reporter.
2015-05-11 | E-GEOD-66755 | biostudies-arrayexpress
Project description:Noncoding RNAs (ncRNAs) comprise an important class of natural regulators that mediate a vast array of biological processes, including the modulation of chromatin architecture. Moreover, artificial ncRNAs have revealed that the functional capabilities of RNA are extremely broad. To further investigate and harness these capabilities, we developed CRISPR-Display ("CRISP-Disp"), a targeted localization strategy that uses Cas9 to deploy large RNA cargos to specific DNA loci. We demonstrate that exogenous RNA domains can be functionally appended onto the CRISPR scaffold at multiple insertion points, allowing the construction of Cas9 complexes with RNAs nearing one kilobase in length, with structured RNAs, protein-binding cassettes, artificial aptamers and pools of random sequences. CRISP-Disp also allows the simultaneous multiplexing of disparate functions at multiple targets. We anticipate that this technology will provide a powerful method with which to ectopically localize functional RNAs and ribonuceloprotein complexes at specified genomic loci. RNA Immunoprecipitation (RIP) against FLAG-tagged Cas9 protein, coexpressed with a large pool of CRISPR RNAs bearing random internal insertions
2015-05-11 | E-GEOD-62305 | biostudies-arrayexpress
Project description:FOXQ1 transcription factors is highly induced in several types of carcinomas where it promotes tumour growth and metastasis, however, the molecular mechanisms leading to FOXQ1 deregulation in cancer are incompletely understood. Here, we used a CRISPR/Cas9-based genomic locus proteomics (GLoPro) to discover transcriptional regulators of FOXQ1 and identified the tumour suppressor p53 as a transcriptional repressor of FOXQ1 expression. ChIP-qPCR as well as complementary gain and loss-of-function assays in model cell lines indicated that p53 has multiple binding sites close to the transcription start site of the FOXQ1 promoter, and that it suppresses FOXQ1 expression in various cell types. Consistently, pharmacological activation of p53 using nutlin-3 or doxorubicin reduced FOXQ1 mRNA and protein levels in colorectal cancer cell lines harboring wild type p53. In conclusion, these results suggest that mutational loss-of-function of p53, a hallmark feature of many types of cancer, de-represses FOXQ1, which accelerates tumour progression.
2024-05-13 | PXD047868 | Pride
Project description:CRISPR screen data
2023-05-31 | E-MTAB-12929 | biostudies-arrayexpress
Project description:Identifying putative transcription factor target genes by combining CRISPR/Cas9-based transcriptional activation with RNAseq in Drosophila S2R+ cells. This study focuses on the transcription factors Twist and Snail, singly and together. RNA from Drosophila cells following CRISPR/Cas9-based activation of Twist, Snail, or Twist and Snail together, compared with non-targeting sgRNA. Two biological replicates for each experiment
2015-08-10 | E-GEOD-71430 | biostudies-arrayexpress
Project description:Long noncoding RNAs (lncRNAs) are a major transcriptional output of the mammalian genome, and their cellular roles are typically assayed by a variety of loss-of-function approaches. This study aims to identify the best current method to deplete nuclear lncRNAs. Small interfering RNAs (RNAi), antisense oligonucleotides (LNAs) and CRISPR interference (CRISPRi) were applied to knock down loc100289019 (a typical nuclear lncRNA, referred to as lnc289) in HeLa cells. We generated sequencing libraries after performing each step of each method, up to and including depletion of lnc289. Differential expression analyses between libraries generated before and after each step allowed us to evaluate the effect of that step on gene expression. The transcriptional effect of lncRNA depletion was then compared to the magnitude of off-target effects inherent to each method.
2017-05-31 | E-MTAB-5308 | biostudies-arrayexpress
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:A genome-wide CRISPR screen was combined with a tdTomato reporter-based epigenetic memory assay to identify factors that erase epigenetic memory in ESC. After introducing genome wide perturbation and dCas9::KRAB-mediated epigenetic editing of the Esg1-tdTomato reporter, the trigger was released and cells that maintained the silencing sorted at FACS. Samples were collected out of sorted tdTomato negative (TOMminus) and positive (TOMplus) cells after 6 days of DOX treatment (epigenetic editing) and 3 or 7 days of DOX washout (release of the trigger), using a gating strategy to separate the bottom 2.5% negative cells (2.5%gate) and cells ranging from mildly to fully repressed (widegate).
2021-11-23 | E-MTAB-10524 | biostudies-arrayexpress
Project description:The aim of this experiment was to identify the RUNX2-dependent transcriptional program in thyroid cancer. To this end TPC1 cell line was infected with dCas9-KRAB and sgRNA targeting RUNX2 distal promoter or a non-targeting sgRNA as control. RNA was collected 10 days after infection and changes in gene expression were evaluated by mRNA-seq. Three replicates were analyzed.
2023-10-20 | E-MTAB-11049 | biostudies-arrayexpress
Project description:West Nile virus (WNV) causes an acute neurological infection attended by massive neuronal cell death. However, the mechanism(s) behind the virus-induced cell death is poorly understood. Using a library containing 77,406 sgRNAs targeting 20,121 genes, we performed a genome-wide screen using CRISPR/Cas9. HEK 293FT cells were infected with lentivirus expressing sgRNAs and then transfected with a Cas9 expressing construct. WNV infection killed most cells during a 12d selection. Survivor cells were harvested, from which DNA was isolated. The sgRNAs integrated in genome of survivor cells were amplified with PCR. The PCR product was sequenced with Illumina MiSeq to profile the sgRNA population in the survivor cells. Three replicates were conducted. Similarly, a second round of screen was conducted. Among the genes identified, seven genes, EMC2, EMC3, SEL1L, DERL2, UBE2G2, UBE2J2, and HRD1, stood out as having the strongest phenotype, whose knockout conferred strong protection against WNV-induced cell death with two different WNV strains and in three cell lines. Interestingly, knockout of these genes did not block WNV replication. Thus, these appear to be essential genes that link WNV replication to downstream cell death pathway(s). In addition, the fact that all of these genes belong to the endoplasmic reticulum-associated protein degradation (ERAD) pathway suggests that this might be the primary driver of WNV-induced cell death. Examination of sgRNA populations in survival 293FT cells
2015-07-05 | E-GEOD-69666 | biostudies-arrayexpress