Dataset Information

Identification of proteins differentially associated with SARS CoV-2 subgenomic RNAs

ABSTRACT: We characterize the specific protein interactomes of 3 SARS sgRNAs (S, N, and ORF8) as well as the gRNA at two time points, 8- and 24- hours. These two timepoints were selected to capture early viral infection when RNA synthesis is just beginning, and viral replication is being established, as well as a later stage where protein synthesis and virion packaging is occurring. We identified over 500 proteins associated with one or more of the viral RNAs. These include both host and viral proteins that have been previously shown to bind to SARS-CoV-2 RNAs and novel (not previously identified) protein interactors.

INSTRUMENT(S): Q Exactive HF

ORGANISM(S): Homo Sapiens (human)

SUBMITTER: Isabella Whitworth

LAB HEAD: Identification of proteins differentially associated with SARS CoV-2 subgenomic RNAs

PROVIDER: PXD040147 | Pride | 2023-07-30

REPOSITORIES: Pride

ACCESS DATA

Dataset's files

Source:

			Action	DRS
	210225_Huh24_1_L_Inj1.raw	Raw
	210225_Huh24_1_L_Inj2.raw	Raw
	210225_Huh24_2_L_Inj1.raw	Raw
	210225_Huh24_2_L_Inj2.raw	Raw
	210225_Huh8_1_L_Inj1.raw	Raw

Items per page:

1 - 5 of 116

Publications

Defining distinct RNA-protein interactomes of SARS-CoV-2 genomic and subgenomic RNAs.

Whitworth Isabella T IT Knoener Rachel A RA Puray-Chavez Maritza M Halfmann Peter P Romero Sofia S Baddouh M'bark M Scalf Mark M Kawaoka Yoshihiro Y Kutluay Sebla B SB Smith Lloyd M LM Sherer Nathan M NM

bioRxiv : the preprint server for biology 20230516

Host RNA binding proteins recognize viral RNA and play key roles in virus replication and antiviral defense mechanisms. SARS-CoV-2 generates a series of tiered subgenomic RNAs (sgRNAs), each encoding distinct viral protein(s) that regulate different aspects of viral replication. Here, for the first time, we demonstrate the successful isolation of SARS-CoV-2 genomic RNA and three distinct sgRNAs (N, S, and ORF8) from a single population of infected cells and characterize their protein interactome ...[more]

PMID: 37293069

Similar Datasets

Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome