Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Freshwater metagenome

ABSTRACT: 16S rRNA amplicon sequencing (V4+V5) from Japanese deep lakes

PROVIDER: PRJDB5151 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	DRR068860.fastq.gz	Fastqsanger.gz
	DRR068861.fastq.gz	Fastqsanger.gz
	DRR068862.fastq.gz	Fastqsanger.gz
	DRR068863.fastq.gz	Fastqsanger.gz
	DRR068864.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 33

Similar Datasets

soil metagenome

Project description:Bacterial 16S rRNA V4-V5 regions

| PRJNA336256 | ENA

Project description:16S v4-v5 amplicon sequencing AD bioreactor

| PRJNA885972 | ENA

freshwater metagenome

Project description:16S rRNA amplicon analysis in BKK

| PRJDB6968 | ENA

freshwater metagenome

Project description:16S rRNA amplicon analysis in HKU

| PRJDB5538 | ENA

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

Evaluating the gut microbiota shifts caused by two diets based on ancient grains

Project description:Total DNA was extracted from stool specimens, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2022-08-24 | GSE206807 | GEO

freshwater metagenome

Project description:Great Lakes targeted amplicon sequencing

| PRJNA217461 | ENA

Microbiota and Complications in Kidney Transplant Recipients

Project description:<p>In this study, we investigated the role of the gut microbiota on the development of complications in kidney transplant recipients. We collected serial fecal specimens from 168 kidney transplant recipients within the first 3 months after transplantation. We performed 16S rRNA gene sequencing of the V4-V5 hypervariable region and examined whether the relative gut abundance of pathogenic bacteria was associated with future development of complications like bacteriuria and urinary tract infections. In a subset of samples, we performed metagenomic sequencing of stool and urine supernatant specimens to determine strain level analysis. </p>

| phs001879 | dbGaP

Comparing the microbiota composition between Cocaine addicted and Healthy subjects and the corresponding shift caused by rTMS treatment.

Project description:Total DNA was extracted from saliva and stool of the patients, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2023-05-31 | GSE206765 | GEO

salt lake metagenome

Project description:Saline shallow lakes 16S and 18S rRNA amplicon sequencing

| PRJNA429605 | ENA