Project description:Sensitive models of climate change impacts would require a better integration of multi-omics approaches that connect the abundance and activity of microbial populations. Here, we show that climate is a fundamental driver of the protein abundance of microbial populations (metaproteomics), yet not their genomic abundance (16S rRNA gene amplicon sequencing), supporting the hypothesis that metabolic activity may be more closely linked to climate than community composition.
Project description:This project focust on proteogenomic characterization of a robust low complexity biocathode community which was enriched from, and cultivated on, the cathode of a microbial solar cell (MSC). This consortium forms a multi-cell layer thick biofilm on the poised electrode surface (+310 mV SHE) and can directly use electrical current as an electron donor to fix CO2 and reduce O2.
Project description:The impact of mono-chronic S. stercoralis infection on the gut microbiome and microbial activities in infected participants was explored. The 16S rRNA gene sequencing of a longitudinal study with 2 sets of human fecal was investigated. Set A, 42 samples were matched, and divided equally into positive (Pos) and negative (Neg) for S. stercoralis diagnoses. Set B, 20 samples of the same participant in before (Ss+PreT) and after (Ss+PostT) treatment was subjected for 16S rRNA sequences and LC-MS/MS to explore the effect of anti-helminthic treatment on microbiome proteomes.
Project description:Industrial anaerobic digestion (AD) represents a relevant energy source beyond today’s fossil fuels, wherein organic matter is recycled to methane gas via an intricate and complex microbial food web. Despite its potential, anaerobic reactors often undergo process instability over time, mainly caused by substrate composition perturbations, making the system unreliable for stable energy production. To ensure the reliability of AD technologies, it is crucial to identify microbial- and system responses to better understand the effect of such perturbations and ultimately detect signatures indicative of process failure . Here, we investigate the effect of microalgal organic loading rate (OLR) on the fermentation products profile, microbiome dynamics, and disruption/recovery of major microbial metabolisms. Reactors subjected to low- and high-OLR disturbances were operated and monitored for fermentation products and biogas production over time, while microbial responses were investigated via 16S rRNA gene amplicon data, shotgun metagenomics and metagenome-centric metaproteomics.
Project description:16S rRNA gene amplicon sequences of bacteria and archaea associated with cathodes modeified with graphene oxide and/or poly(3,4-ethylenedioxythiophene)
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.