Project description:long-read CAGE was design to identify full length capped transcript across 10 specific loci in cortical neurones. Long-read CAGE was based on the Cap-Trapper method with the full length cDNA sequencing using ONT MinION sequencer. After RNA extraction, 10 µg total RNAs from Human iPS (WTC-11) cells, differentiated neural stem cells and differentiated cortical neuron cells were polyadenylated with E-coli poly(A) Polymerase (PAP) (NEB M0276) at 37°C for 15 min and purified with AMPure RNA Clean XP beads. The PAP treated 5 µg RNA was reverse transcribed with oligodT_16VN_UMI25_primer (GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNNNNNNNNNNNCTACGTTTTTTTTTTTTTTTTVN) and Prime Script II Reverse Transcriptase (Takara Bio) at 42°C for 60 min and purified with RNAClean XP beads. Cap-trapping from the RNA/cDNA hybrids was performed with published protocol (Takahashi et al., Nature protocols, 2012 (https://doi.org/10.1038/nprot.2012.005)), and RNA was digested with RNase H (Takara Bio) at 37°C for 30 min and purified with AMPureXP beads. 5’ linker (N6 up GTGGTATCAACGCAGAGTACNNNNNN-Phos, GN5 up GTGGTATCAACGCAGAGTACGNNNNN-Phos, down Phos-GTACTCTGCGTTGATACCAC-Phos) was ligated to the cDNA with Mighty Mix (Takara Bio) for overnight and the ligated cDNA was purified with AMPure XP beads. Shrimp Alkaline Phosphatase (Takara Bio) was used to remove phosphates at the ligated linker and purified with AMPureXP beads. The 5’ linker ligated cDNA was then second strand synthesized with KAPA HiFi mix (Roche) and 2nd synthesis primer_UMI15 at 95°C for 5 min, 55°C for 5 min and 72°C for 30 min. Exonuclease I (Takara Bio) was added for the primer digestion at 37°C for 30 min, and the cDNA/DNA hybrid was purified with AMPureXP and amplified with PrimerSTAR GXL DNA polymerase (Takara Bio) and PCR primer (fwd_CTACACTCGTCGGCAGCGTC, rev _GAGATGTCTCGTGGGCTCGG) for 7 cycles. The library was then treated with SQK-LSK110 (Oxford Nanopore Technologies) with manufacture’s protocol and sequenced with R9.4 flowcell (FLO-MIN106) in MinION sequencer. Basecalling was processed by Guppy v5.0.14 basecaller software provided by Oxford Nanopore Technologies to generate fastq files from FAST5 files. To prepare clean reads from fastq files, adapter sequence was trimmed by pychopper (https://github.com/nanoporetech/pychopper) with VNP_GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNCTACG and SSP_ CTACACTCGTCGGCAGCGTCNNNNNNNNNNNNNNNNNNNNNNNNNGTGGTATCAACGCAGAGTAC and the fastq was mapped on our target genes.
Project description:Purpose: The aim of this study is to identify genes that are under the transcriptional control of the epigenetic modifier Smchd1 in mouse neural stem cells. We profiled the transcriptomes of mouse neural stem cells from samples that were either wild-type or contained a null mutation in the epigenetic regulator Smchd1 using Oxford Nanopore Technologies (ONT) direct cDNA sequencing protocol and a PromethION sequencer.
Project description:We applied direct RNA long read sequencing for characterization of transcripts from constructs inserted into HEK293T mammalian cells with different promoters. Direct RNA sequencing was performed on an Oxford Nanopore GridION device using the Direct Sequencing Kit (SQK-RNA004, date accessed 15 May 2024), MinION RNA flow cell (FLO-MIN00RA), and data pre-processing was performed with MinKNOW (v24.06.10).
Project description:In this experiment we wanted to see how the binding behavior of the S. Cerevisiae transcription factor Leu3, on of the main regulators of leucine biosynthesis, is affected by different availability of the branched chain amino acids. For this we grow the cells in shake flask under glucose limitation and treated them 2 hours before sampling. The cells were then cross-linked with formaldehyde and ChIP-seq was performed using the Oxford Nanopore MinIon.
Project description:To evaluate targeted MinION next generation sequencing as a diagnostic method for detection of pathogens in human blood and plasma, human blood or plasma samples were spiked with measured amounts of viruses, bacteria, protozoan parasites or tested pathogen-free as negative controls. Nucleic acid was extracted from samples and PCR amplification performed in multiplex primer pools with a procedure described in ArrayExpress experiment submission ID 18379. The PCR products were used for library preparation. The libraries sequenced on an Oxford Nanopore MinION. The passed reads aligned with a custom reference file to determine the identity of the pathogen in the sample.
Project description:We present scNanoATAC-seq (Single-cell Assay for Transposase Accessible Chromatin by Oxford Nanopore Technologies Sequencing), an effective method for simultaneous detection of chromatin accessibility and genetic variation. Long fragments (about 4-5Kb) of single-cell ATAC-seq library were enriched and sequenced by Oxford Nanopore Technologies platform. Ends of long ATAC-seq fragments are regarded as chromatin accessibility signal in downstream analysis.