Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Microbial community composition in manure biogas plants

ABSTRACT: The Illumina MiSeq platform was used to investigate and identify the microbial community based on 16S rRNA V4 region.

PROVIDER: PRJEB10894 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	ERR1019010_1.fastq.gz	Fastqsanger.gz
	ERR1019010_2.fastq.gz	Fastqsanger.gz
	ERR1019020_1.fastq.gz	Fastqsanger.gz
	ERR1019020_2.fastq.gz	Fastqsanger.gz
	ERR1019011_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 154

Similar Datasets

Comparing the microbiota composition between HPV positive and negative patients with CRC

Project description:Total DNA was extracted from the stool of the patients, amplified to collect amplicons of variable V3–V4 regions (primers 341F and 805R) of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2023-10-15 | GSE216589 | GEO

Analysis of microbiota composition within breast tumor and healthy breast tissues in males and females

Project description:Total DNA was extracted from FFPE specimens of breast tumor and surrounding healthy tissue, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2023-06-14 | GSE212891 | GEO

Comparing the microbiota composition between Cocaine addicted and Healthy subjects and the corresponding shift caused by rTMS treatment.

Project description:Total DNA was extracted from saliva and stool of the patients, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2023-05-31 | GSE206765 | GEO

Microbial community composition in anaerobic digesters fed low and high concentrations of acetate

Project description:Using Illumina MiSeq platform for amplicon sequencing of 16S rRNA V4 region

| PRJEB10871 | ENA

Metagenomic sequencing of two full scale manure co-digesting biogas plants

Project description:The Illumina HiSeq 2000 platform was used to sequence two metagenomes from two Danish biogas plants.

| PRJEB10932 | ENA

Evaluating the gut microbiota shifts caused by two diets based on ancient grains

Project description:Total DNA was extracted from stool specimens, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2022-08-24 | GSE206807 | GEO

Microbiome Diversity and Community-Level Change Points within Manure-based small Biogas Plants.

Project description:Efforts to integrate biogas plants into bioeconomy concepts will lead to an expansion of manure-based (small) biogas plants, while their operation is challenging due to critical characteristics of some types of livestock manure. For a better process understanding, in this study, three manure-based small biogas plants were investigated with emphasis on microbiome diversity. Due to varying digester types, feedstocks, and process conditions, 16S rRNA gene amplicon sequencing showed differences in the taxonomic composition. Dynamic variations of each investigated biogas plant microbiome over time were analyzed by terminal restriction fragment length polymorphism (TRFLP), whereby nonmetric multidimensional scaling (NMDS) revealed two well-running systems, one of them with a high share of chicken manure, and one unstable system. By using Threshold Indicator Taxa Analysis (TITAN), community-level change points at ammonium and ammonia concentrations of 2.25 g L-1 and 193 mg L-1 or volatile fatty acid concentrations of 0.75 g L-1were reliably identified which are lower than the commonly reported thresholds for critical process stages based on chemical parameters. Although a change in the microbiome structure does not necessarily indicate an upcoming critical process stage, the recorded community-level change points might be a first indication to carefully observe the process.

| S-EPMC7464807 | biostudies-literature

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

ena-DATASET-KULVIB-19-10-2018-12:35:21:241-524 - samples

Project description:16S rRNA gene sequencing with Illumina MiSeq (V4 hypervariable region)

| EGAD00001004406 | EGA

a7bcbc51-217a-491f-808b-617da8eeca65 - samples

Project description:Fecal samples Illumina MiSeq 16S rRNA sequencing, V4 hypervariable region

| EGAD00001004106 | EGA