Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Foxh1/nodal defines context-specific direct maternal Wnt/Beta-catenin target gene regulation in early development

ABSTRACT: Foxh1/nodal defines context-specific direct maternal Wnt/Beta-catenin target gene regulation in early development

PROVIDER: PRJEB35638 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	ERR3697980_1.fastq.gz	Fastqsanger.gz
	ERR3697980_2.fastq.gz	Fastqsanger.gz
	ERR3697990_1.fastq.gz	Fastqsanger.gz
	ERR3697990_2.fastq.gz	Fastqsanger.gz
	ERR3698000_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 90

Similar Datasets

Foxh1/nodal defines context-specific direct maternal Wnt/Beta-catenin target gene regulation in early development

Project description:This study aimed to further understand context-specific direct Wnt target gene expression through the use of beta-catenin and FoxH1 ChIP Sequencing data at various developmental stages representing both maternal and zygotic Wnt signalling. Results were further supported through the use of RNA sequencing data from beta-catenin, FoxH1 and nodal gene knock down assays.

2020-06-21 | E-MTAB-8555 | biostudies-arrayexpress

Foxh1/Nodal Defines Context-Specific Direct Maternal Wnt/β-Catenin Target Gene Regulation in Early Development.

Project description:Although Wnt/β-catenin signaling is generally conserved and well understood, the regulatory mechanisms controlling context-specific direct Wnt target gene expression in development and disease are still unclear. The onset of zygotic gene transcription in early embryogenesis represents an ideal, accessible experimental system to investigate context-specific direct Wnt target gene regulation. We combine transcriptomics using RNA-seq with genome-wide β-catenin association using ChIP-seq to identify stage-specific direct Wnt target genes. We propose coherent feedforward regulation involving two distinct classes of direct maternal Wnt target genes, which differ both in expression and persistence of β-catenin association. We discover that genomic β-catenin association overlaps with Foxh1-associated regulatory sequences and demonstrate that direct maternal Wnt target gene expression requires Foxh1 function and Nodal/Tgfβ signaling. Our results support a new paradigm for direct Wnt target gene co-regulation with context-specific mechanisms that will inform future studies of embryonic development and more widely stem cell-mediated homeostasis and human disease.

| S-EPMC7347983 | biostudies-literature

HEB and E2A function as SMAD/FOXH1 cofactors

Project description:Nodal signaling, mediated through SMAD transcription factors, is necessary for pluripotency maintenance and endoderm commitment. We have identified a new motif, termed SMAD Complex Associated (SCA) that is bound by SMAD2/3/4 and FOXH1 in human embryonic stem cells (hESCs) and derived endoderm. We demonstrate that two bHLH proteins - HEB and E2A - bind the SCA motif at regions overlapping SMAD2/3 and FOXH1. Further, we show that HEB and E2A associate with SMAD2/3 and FOXH1, suggesting they form a complex at critical target regions. This association is biologically important, as E2A is critical for mesendoderm specification, gastrulation, and Nodal signal transduction in Xenopus tropicalis embryos. Taken together, E2A is a novel Nodal signaling cofactor that associates with SMAD2/3 and FOXH1 and is necessary for mesendoderm differentiation. ChIP-seq of Smad2/3 and Input in X.tropicalis, stage 10.5 embryo.

2011-08-23 | E-GEOD-30146 | biostudies-arrayexpress

Genome-wide analysis of Smad2 and FoxH1 binding sites in zebrafish blastula

Project description:Morphogen gradients expose cells to different signal concentrations and induce target genes with different ranges of expression. To determine how the Nodal morphogen gradient induces distinct gene expression patterns during zebrafish embryogenesis we characterized the binding sites of the Nodal-specific transcription co-activators Smad2 and FoxH1 in wild-type, Nodal-overexpressing or Nodal signaling inhibited embryos. We found that FoxH1 binds to Nodal targets loci even in the absence of the signal, while Smad2 only binds and colocalizes to FoxH1 upon induction of the Nodal pathway.

2015-04-08 | GSE67648 | GEO

HEB and E2A function as SMAD/FOXH1 cofactors

2011-08-23 | GSE30146 | GEO

Genome-wide view of TGFb/Foxh1 regulation of the early mesendoderm program [RNA-seq]

Project description:We identified Nodal and Foxh1 downstream targets by performing RNA-seq of embryos either treated with small molecule SB431542 or microinjected morpholino anti-sense oligo against Foxh1.

2014-11-07 | GSE53653 | GEO

Genome-wide view of TGFb/Foxh1 regulation of the early mesendoderm program [ChIP-seq]

Project description:We defined the genome-wide binding regions of Smad2/3 and Foxh1 at mid-gastrula stage Xenopus tropicalis embryos, at which Nodal signaling and Foxh1 are critical in mesendoderm specification program.

2014-11-07 | GSE53652 | GEO

Foxh1 marks the embryonic genome prior to the activation of the mesendoderm gene regulatory program

Project description:We examined the binding dynamics of the maternal TF Foxh1 over a time course of germ layer development. Foxh1 binding was compared to the onset of zygotic transcription (RNA pol II), binding of the co-repressor Tle, Nodal signaling (Smad2/3) and the zygotic endoderm TF Foxa.

2017-03-30 | GSE85273 | GEO

Identification of differentially-expressed genes between FoxH1 morpholino and control in zebrafish embryos.

Project description:The Forkhead Box H1 (FoxH1) protein is a co-transcription factor recruited by phosphorylated Smad2 downstream of several TGFbetas, including Nodal-related proteins. We have reassessed the function of zebrafish FoxH1 using antisense morpholino oligonucleotides (MOs) ( 5’ TGCTTTGTCATGCTGATGTAGTGGG 3’) as compared with a control morpholino (MO) with no specific target (5’ TAGTTAAGCCTAGCTCTCATAAACT 3’). Probing FoxH1 morphant RNA by microarray, we identified a cohort of five keratin genes – cyt1, cyt2, krt4, krt8 and krt18 - that are normally transcribed in the embryo’s enveloping layer (EVL) and which have significantly reduced expression in FoxH1-depleted embryos. Keywords: 40% epiboly-stage embryos, injected with either 8 ng of a 25mer morpholino (MO) with no specific target or 8 ng of a 25mer MO with reverse complementary to the 5’ untranslated region of the zebrafish foxH1 gene.

2007-07-30 | GSE8076 | GEO

Tissue-intrinsic beta-catenin signals antagonize Nodal-driven anterior visceral endoderm differentiation

Project description:The anterior-posterior axis of the mammalian embryo is laid down by the anterior visceral endoderm (AVE), an extraembryonic signaling center that is specified within the visceral endoderm. Current models posit that AVE differentiation is promoted globally by epiblast-derived Nodal signals, and spatially restricted by a BMP gradient established by the extraembryonic ectoderm. Here, we report spatially restricted AVE differentiation in bilayered embryo-like aggregates made from mouse embryonic stem cells that lack an extraembryonic ectoderm. Notably, clusters of AVE cells also form in pure visceral endoderm cultures upon activation of Nodal signaling, indicating that tissue-intrinsic factors can restrict AVE differentiation. We identify β-catenin activity as a tissue-intrinsic factor that antagonizes AVE-inducing Nodal signals. Together, our results show how an AVE-like population can arise through interactions between epiblast and visceral endoderm alone. This mechanism may be a flexible solution for axis patterning in a wide range of embryo geometries, and provide robustness to axis patterning when coupled with signal gradients.

2023-05-19 | GSE198780 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data