Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Human fecal samples

ABSTRACT: Human fecal samples microbial 16S rRNA gene sequence

PROVIDER: PRJEB39539 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	ERR4383820_1.fastq.gz	Fastqsanger.gz
	ERR4383820_2.fastq.gz	Fastqsanger.gz
	ERR4383821_1.fastq.gz	Fastqsanger.gz
	ERR4383821_2.fastq.gz	Fastqsanger.gz
	ERR4383812_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 32

Similar Datasets

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

Human fecal samples

Project description:Human fecal samples Raw sequence reads

| PRJNA898842 | ENA

Human fecal samples

Project description:Human fecal samples Raw sequence reads

| PRJNA778908 | ENA

Human fecal samples

Project description:Human fecal samples Raw sequence reads

| PRJNA1092365 | ENA

Metaproteomic analysis of the infant fecal microbiome

Project description:A metaproteomics analysis was conducted on the infant fecal microbiome to characterize global protein expression in 8 samples obtained from infants with a range of early-life experiences. Samples included breast-, formula- or mixed-fed, mode of delivery, and antibiotic treatment and one set of monozygotic twins. Although label-free mass spectrometry-based proteomics is routinely used for the identification and quantification of thousands of proteins in complex samples, the metaproteomic analysis of the gut microbiome presents particular technical challenges. Among them: the extreme complexity and dynamic range of member taxa/species, the need for matched, well-annotated metagenomics databases, and the high inter-protein sequence redundancy/similarity between related members. In this study, a metaproteomic approach was developed for assessment of the biological phenotype and functioning, as a complement to 16S rRNA sequencing analysis to identify constituent taxa. A sample preparation method was developed for recovery and lysis of bacterial cells, followed by trypsin digestion, and pre-fractionation using Strong Cation Exchange chromatography. Samples were then subjected to high performance LC-MS/MS. Data was searched against the Human Microbiome Project database, and a homology-based meta-clustering strategy was used to combine peptides from multiple species into representative proteins. Bacterial taxonomies were also identified, based on species-specific protein sequences, and protein metaclusters were assigned to pathways and functional groups. The results obtained demonstrate the applicability of this approach for performing qualitative comparisons of human fecal microbiome composition, physiology and metabolism, and also provided a more detailed assessment of microbial composition in comparison to 16S rRNA.

2019-03-29 | PXD006033 | Pride

Human fecal samples

Project description:Human fecal samples Metagenome

| PRJNA1148078 | ENA

human fecal samples

Project description:human fecal samples Metagenome

| PRJNA517270 | ENA

Human fecal samples

Project description:Human fecal samples Raw sequence reads (host removed)

| PRJNA924942 | ENA

Chronic Strongyloides stercoralis infection increases Ruminococcus torques group and alter microbiome proteome in ivermectin treatment

Project description:The impact of mono-chronic S. stercoralis infection on the gut microbiome and microbial activities in infected participants was explored. The 16S rRNA gene sequencing of a longitudinal study with 2 sets of human fecal was investigated. Set A, 42 samples were matched, and divided equally into positive (Pos) and negative (Neg) for S. stercoralis diagnoses. Set B, 20 samples of the same participant in before (Ss+PreT) and after (Ss+PostT) treatment was subjected for 16S rRNA sequences and LC-MS/MS to explore the effect of anti-helminthic treatment on microbiome proteomes.

2023-11-07 | PXD037975 | JPOST Repository

High-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.

2022-04-02 | GSE199749 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data