Sargassum16SrRNA_GASBcoast
Ontology highlight
ABSTRACT:
PROVIDER: PRJEB58262 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.
2022-04-02 | GSE199749 | GEO
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO
Project description:Here we report a direct tRNA sequencing protocol and software to simultaneously examine the composition and biological activity of naturally occurring microbial communities. Our analysis of mouse gut microbiome with tRNA-seq and 16S ribosomal RNA gene amplicons revealed comparable microbial community structures, and additional physiological insights into the microbiome through tRNA abundance and modifications.
2018-11-09 | GSE100263 | GEO
Project description:Protein expression by E. coli 26561 during the late-exponential phase of cultures under anaerobic conditions was examined. E. coli 26561 is a multidrug resistant (MDR) and shows an unusual hyper-mucoviscous phenotype. Resistance includes ESBL (CTX-M-14) and proteome was determined with and without exposure to sub-MIC concentrations of the 3rd generation cephalosporin ceftazidime. Ceftazidime exposure was at two sub-MIC levels, specifically 0.25x MIC (samples 5-7), 0.5x MIC (samples 8 - 10); samples 1-4 provided the unexposed Control. Both whole and phospho-enriched fractions for each sample were analysed. Quantification of peptides was assessed using 10-plex TMT labelling in conjunction with an Orbitrap Fusion Tribrid. Raw data produced by the Orbitrap were processed using Max Quant 1.5.4.7 using the included Andromeda search engine. Peptides were searched against our own database of E. coli 26561 proteins which was produced from a hybrid assembly of our reads obtained from MiSeq and PacBio sequencing platforms.
2018-08-22 | PXD008339 | Pride
Project description:Total DNA was extracted from stool specimens, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.
2022-08-24 | GSE206807 | GEO
Project description:Sargassum is one of the most diverse brown algal genus with more than 150 known species, mostly benthic and few pelagic species. They contribute significantly to global primary production and serve as important habitat for wide range of marine organisms. Sargassum vulgare is one of the dominant habitat forming species along Mediterranean coast. Despite their huge ecological importance, it is relatively unknown how they will respond under future global climate change scenario. This work used de novo transcriptome sequencing approach to understand the molecular response of S. vulgare to chronic acidification at the shallow underwater volcanic CO2 vents off Ischia Island, Italy. Keywords: brown algae, Sargassum, de novo transcriptome, ocean acidification, CO2 vents.
2017-01-16 | GSE78707 | GEO
Project description:Total DNA was extracted from saliva and stool of the patients, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.
2023-05-31 | GSE206765 | GEO
Project description:Nitrate-reducing iron(II)-oxidizing bacteria are widespread in the environment contribute to nitrate removal and influence the fate of the greenhouse gases nitrous oxide and carbon dioxide. The autotrophic growth of nitrate-reducing iron(II)-oxidizing bacteria is rarely investigated and poorly understood. The most prominent model system for this type of studies is enrichment culture KS, which originates from a freshwater sediment in Bremen, Germany. To gain insights in the metabolism of nitrate reduction coupled to iron(II) oxidation under in the absence of organic carbon and oxygen limited conditions, we performed metagenomic, metatranscriptomic and metaproteomic analyses of culture KS. Raw sequencing data of 16S rRNA amplicon sequencing, shotgun metagenomics (short reads: Illumina; long reads: Oxford Nanopore Technologies), metagenome assembly, raw sequencing data of shotgun metatranscriptomes (2 conditions, triplicates) can be found at SRA in https://www.ncbi.nlm.nih.gov/bioproject/PRJNA682552. This dataset contains proteomics data for 2 conditions (heterotrophic and autotrophic growth conditions) in triplicates.
2021-05-17 | PXD023186 | Pride
Project description:Total bacterial DNA was isolated from water and sediment samples from a local watershed and 16S rRNA sequences were analyzed using the Illumina MiSeq v3 platform in order to generate snapshots of bacterial community profiles.
2016-01-01 | GSE73842 | GEO