Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: 16S rRNA sequencing of Falcataria falcata root nodules in Guangdong, Southern China

PROVIDER: PRJNA1009201 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR25762846_subreads.fastq.gz	Fastqsanger.gz
	SRR25762847_subreads.fastq.gz	Fastqsanger.gz
	SRR25762848_subreads.fastq.gz	Fastqsanger.gz
	SRR25762849_subreads.fastq.gz	Fastqsanger.gz
	SRR25762850_subreads.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 31

Similar Datasets

Gut microbiota analysis of kdm5 mutant and the flies with KDM5 knockdown in intestine tissue

Project description:To determine microbiota composition associated with loss of KDM5 in intestine, we carried out 16S rRNA seq analyses of dissected intestine from wildtype and kdm5 mutant. [GSM2628181-GSM2628190]. A total of 78 operational taxonomic units (OTUs) were identified in the sequence data. There were about 15 genera much less abundant in kdm5 mutant compared to wildtype. The kdm5 mutant were sensitive to pathogen. To confirm the microbiota associated with loss of KDM5 in intestine, 16S rRNA of new flies were sequenced and analyzed by Majorbio Bio-Pharm Technology Co. Ltd. (Shanghai, China) [GSM3243472-GSM3243481]. A total of 107 operational taxonomic units (OTUs) were identified in the sequence data. There were about 20 genera much less abundant in kdm5 mutant compared to wildtype. To confirm the microbiota associated with loss of KDM5 drosophila feeding with Lactobacillus plantarum, 16S rRNA of kdm5 mutant flies were sequenced and analyzed by Novogene Bioinformatics Technology Co., Ltd. (Tianjin, China) [GSM3263522-GSM3263527]. A total of 92 operational taxonomic units (OTUs) were identified in the sequence data. To confirm the microbiota associated with KDM5 knockdown in intestine, 16S rRNA of Myo1A-Gal4TS/+ and Myo1A-Gal4TS/+;+/kdm5RNAi flies were sequenced and analyzed by Biomarker Co. Ltd. (Beijing, China). [GSM3507915-GSM3507924]. A total of 50 operational taxonomic units (OTUs) were identified in the sequence data. There was a significant different based on the genus level between two groups.

2019-02-08 | GSE98944 | GEO

Study of Gut Microbiome and Colorectal Tumors

Project description:Gut microbiota were assessed in 540 colonoscopy-screened adults by 16S rRNA gene sequencing of stool samples. Investigators compared gut microbiota diversity, overall composition, and normalized taxon abundance among these groups.

| 2255499 | ecrin-mdr-crc

Chronic Strongyloides stercoralis infection increases Ruminococcus torques group and alter microbiome proteome in ivermectin treatment

Project description:The impact of mono-chronic S. stercoralis infection on the gut microbiome and microbial activities in infected participants was explored. The 16S rRNA gene sequencing of a longitudinal study with 2 sets of human fecal was investigated. Set A, 42 samples were matched, and divided equally into positive (Pos) and negative (Neg) for S. stercoralis diagnoses. Set B, 20 samples of the same participant in before (Ss+PreT) and after (Ss+PostT) treatment was subjected for 16S rRNA sequences and LC-MS/MS to explore the effect of anti-helminthic treatment on microbiome proteomes.

2023-11-07 | PXD037975 | JPOST Repository

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

Changes of intestinal flora in patients with epithelial ovarian cancer treated with PARP inhibitor first-line maintenance therapy: a non-randomized, double-blind, observational cohort study

Project description:Interventions: Follow-up observation group:no;A drug maintenance treatment group:no;Two kinds of drugs maintenance treatment group:no Primary outcome(s): 16s rRNA sequencing results;Evaluation of therapeutic response in solid tumors Study Design: Cohort study

| 105717 | ecrin-mdr-crc

The effect of IV iron on the gut microbiome in patients with metastatic colorectal cancer

Project description:Primary outcome(s): Analysis of the diversity and composition of the gut microbiome by 16S rRNA sequencing Study Design: Observational Study Model : Others, Time Perspective : Prospective, Enrollment : 60, Biospecimen Retention : Collect & Archive- Sample with DNA, Biospecimen Description : Blood, Stool

| 26030 | ecrin-mdr-crc

Microbial community structure and functions are resilient to metal pollution along two forest soil gradients

Project description:Despite the global importance of forests, it is virtually unknown how their soil microbial communities adapt at the phylogenetic and functional level to long term metal pollution. Studying twelve sites located along two distinct gradients of metal pollution in Southern Poland revealed that both community composition (via MiSeq Illumina sequencing of 16S rRNA genes) and functional gene potential (using GeoChip 4.2) were highly similar across the gradients despite drastically diverging metal contamination levels. Metal pollution level significantly impacted microbial community structure (p = 0.037), but not bacterial taxon richness. Metal pollution altered the relative abundance of specific bacterial taxa, including Acidobacteria, Actinobacteria, Bacteroidetes, Chloroflexi, Firmicutes, Planctomycetes and Proteobacteria. Also, a group of metal resistance genes showed significant correlations with metal concentrations in soil, although no clear impact of metal pollution levels on overall functional diversity and structure of microbial communities was observed. While screens of phylogenetic marker genes, such as 16S rRNA, provided only limited insight into resilience mechanisms, analysis of specific functional genes, e.g. involved in metal resistance, appeared to be a more promising strategy. This study showed that the effect of metal pollution on soil microbial communities was not straightforward, but could be filtered out from natural variation and habitat factors by multivariate statistical analysis and spatial sampling involving separate pollution gradients. 12 samples were collected from two long-term polluted areas (Olkusz and Miasteczko M-EM-^ZlM-DM-^Eskie) in Southern Poland. In the study presented here, a consecutively operated, well-defined cohort of 50 NSCLC cases, followed up more than five years, was used to acquire expression profiles of a total of 8,644 unique genes, leading to the successful construction of supervised

2014-07-22 | E-GEOD-59620 | biostudies-arrayexpress

IL-22 resolves MASLD via enterocyte STAT3 restoration of diet perturbed intestinal homeostasis [16s rDNA-seq]

Project description:IL22 induces antimicrobial peptides which influnce microbiota. We used 16s rRNA gene sequencing (16s DNA-seq) to analyze the microbiota with Fc or IL-22Fc treatment.

2024-08-01 | GSE242929 | GEO

16s rRNA-young and old mouse gut microbiota-stroke

Project description:To explore the effects of gut microbiota of young (8 weeks) or old mice (18～20 months) on stroke, feces of young (Y1-Y9) and old mice (O6-O16) were collected and analyzed by 16s rRNA sequencing. Then stroke model was established on young mouse receive feces from old mouse (DOT1-15) and young mouse receive feces from young mouse (DYT1-15). 16s rRNA sequencing were also performed for those young mice received feces from young and old mice.

2021-10-15 | E-MTAB-10837 | biostudies-arrayexpress

insect metagenome

Project description:Virome of ants by metagenomic analysis in Guangdong, southern China

| PRJNA1061181 | ENA