Ontology highlight
ABSTRACT:
PROVIDER: PRJNA1016136 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR26047400_1.fastq.gz | Fastqsanger.gz | |||
| SRR26047400_2.fastq.gz | Fastqsanger.gz | |||
| SRR26047500_1.fastq.gz | Fastqsanger.gz | |||
| SRR26047500_2.fastq.gz | Fastqsanger.gz | |||
| SRR26047401_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 306 |
Similar Datasets
Project description:To effectively monitor microbial populations in acidic environments and bioleaching systems, a comprehensive 50-mer-based oligonucleotide microarray was developed based on most of the known genes associated with the acidophiles. This array contained 1,072 probes in which there were 571 related to 16S rRNA and 501 related to functional genes. Acid mine drainage (AMD) presents numerous problems to the aquatic life and surrounding ecosystems. However, little is known about the geographic distribution, diversity, composition, structure and function of AMD microbial communities. In this study, we analyzed the geographic distribution of AMD microbial communities from twenty sites using restriction fragment length polymorphism (RFLP) analysis of 16S rRNA genes, and the results showed that AMD microbial communities were geographically distributed and had high variations among different sites. Then an AMD-specific microarray was used to further analyze nine AMD microbial communities, and showed that those nine AMD microbial communities had high variations measured by the number of detected genes, overlapping genes between samples, unique genes, and diversity indices. Statistical analyses indicated that the concentrations of Fe, S, Ca, Mg, Zn, Cu and pH had strong impacts on both phylogenetic and functional diversity, composition, and structure of AMD microbial communities. This study provides insights into our understanding of the geographic distribution, diversity, composition, structure and functional potential of AMD microbial communities and key environmental factors shaping them. This study investigated the geographic distribution of Acid Mine Drainages microbial communities using a 16S rRNA gene-based RFLP method and the diversity, composition and structure of AMD microbial communities phylogenetically and functionally using an AMD-specific microarray which contained 1,072 probes ( 571 related to 16S rRNA and 501 related to functional genes). The functional genes in the microarray were involved in carbon metabolism (158), nitrogen metabolism (72), sulfur metabolism (39), iron metabolism (68), DNA replication and repair (97), metal-resistance (27), membrane-relate gene (16), transposon (13) and IST sequence (11).
2011-03-08 | E-GEOD-27542 | biostudies-arrayexpress
Project description:A combination of shotgun metaproteomics and 16S rRNA gene pyrosequencing wasused to identify potential functional pathways and key microorganisms involved in long-chain fatty acids (LCFA) anaerobic conversion. Microbial communities degrading saturated- and unsaturated-LCFA were compared. Archaeal communities were mainly composed of Methanosaeta, Methanobacterium and Methanospirillum species, both in stearate (saturated C18:0) and oleate (mono-unsaturated C18:1) incubations. Over 80% of the 16S rRNA gene sequences clustered within the Methanosaeta genus, which is in agreement with the high number of proteins assigned to this group (94%). Archaeal proteins related with methane metabolism were highly expressed. Bacterial communities were rather diverse and the composition dissimilar between incubations with saturated- and unsaturated-LCFA. Stearate-degrading communities were enriched in Deltaproteobacteria (34% of the assigned sequences), while microorganisms clustering within the Synergistia class were more predominant in oleate incubation (25% of the assigned sequences). Bacterial communities were diverse and active, given by the high percentage of proteins related with mechanisms of energy production. Several proteins were assigned to syntrophic bacteria, emphasizing the importance of the interactions between acetogens and methanogens in energy exchange and formation in anaerobic LCFA-rich environments.
2024-05-03 | PXD047617 | Pride
Project description:A combination of shotgun metaproteomics and 16S rRNA gene pyrosequencing wasused to identify potential functional pathways and key microorganisms involved in long-chain fatty acids (LCFA) anaerobic conversion. Microbial communities degrading saturated- and unsaturated-LCFA were compared. Archaeal communities were mainly composed of Methanosaeta, Methanobacterium and Methanospirillum species, both in stearate (saturated C18:0) and oleate (mono-unsaturated C18:1) incubations. Over 80% of the 16S rRNA gene sequences clustered within the Methanosaeta genus, which is in agreement with the high number of proteins assigned to this group (94%). Archaeal proteins related with methane metabolism were highly expressed. Bacterial communities were rather diverse and the composition dissimilar between incubations with saturated- and unsaturated-LCFA. Stearate-degrading communities were enriched in Deltaproteobacteria (34% of the assigned sequences), while microorganisms clustering within the Synergistia class were more predominant in oleate incubation (25% of the assigned sequences). Bacterial communities were diverse and active, given by the high percentage of proteins related with mechanisms of energy production. Several proteins were assigned to syntrophic bacteria, emphasizing the importance of the interactions between acetogens and methanogens in energy exchange and formation in anaerobic LCFA-rich environments.
2024-05-03 | PXD047711 | Pride
Project description:A combination of shotgun metaproteomics and 16S rRNA gene pyrosequencing wasused to identify potential functional pathways and key microorganisms involved in long-chain fatty acids (LCFA) anaerobic conversion. Microbial communities degrading saturated- and unsaturated-LCFA were compared. Archaeal communities were mainly composed of Methanosaeta, Methanobacterium and Methanospirillum species, both in stearate (saturated C18:0) and oleate (mono-unsaturated C18:1) incubations. Over 80% of the 16S rRNA gene sequences clustered within the Methanosaeta genus, which is in agreement with the high number of proteins assigned to this group (94%). Archaeal proteins related with methane metabolism were highly expressed. Bacterial communities were rather diverse and the composition dissimilar between incubations with saturated- and unsaturated-LCFA. Stearate-degrading communities were enriched in Deltaproteobacteria (34% of the assigned sequences), while microorganisms clustering within the Synergistia class were more predominant in oleate incubation (25% of the assigned sequences). Bacterial communities were diverse and active, given by the high percentage of proteins related with mechanisms of energy production. Several proteins were assigned to syntrophic bacteria, emphasizing the importance of the interactions between acetogens and methanogens in energy exchange and formation in anaerobic LCFA-rich environments.
2024-05-03 | PXD047824 | Pride
Project description:A combination of shotgun metaproteomics and 16S rRNA gene pyrosequencing wasused to identify potential functional pathways and key microorganisms involved in long-chain fatty acids (LCFA) anaerobic conversion. Microbial communities degrading saturated- and unsaturated-LCFA were compared. Archaeal communities were mainly composed of Methanosaeta, Methanobacterium and Methanospirillum species, both in stearate (saturated C18:0) and oleate (mono-unsaturated C18:1) incubations. Over 80% of the 16S rRNA gene sequences clustered within the Methanosaeta genus, which is in agreement with the high number of proteins assigned to this group (94%). Archaeal proteins related with methane metabolism were highly expressed. Bacterial communities were rather diverse and the composition dissimilar between incubations with saturated- and unsaturated-LCFA. Stearate-degrading communities were enriched in Deltaproteobacteria (34% of the assigned sequences), while microorganisms clustering within the Synergistia class were more predominant in oleate incubation (25% of the assigned sequences). Bacterial communities were diverse and active, given by the high percentage of proteins related with mechanisms of energy production. Several proteins were assigned to syntrophic bacteria, emphasizing the importance of the interactions between acetogens and methanogens in energy exchange and formation in anaerobic LCFA-rich environments.
2024-05-03 | PXD047715 | Pride
Project description:Sensitive models of climate change impacts would require a better integration of multi-omics approaches that connect the abundance and activity of microbial populations. Here, we show that climate is a fundamental driver of the protein abundance of microbial populations (metaproteomics), yet not their genomic abundance (16S rRNA gene amplicon sequencing), supporting the hypothesis that metabolic activity may be more closely linked to climate than community composition.
2022-03-01 | PXD009773 | Pride
Project description:Interventions: Case (colorectal cancer) group:a newly diagnosed colorectal cancer( CRC ) by colonoscopy and pathology;Control group:Clinically healthy volunteers with no symptoms or history of intestinal disease(e.g. colonic adenomatous polyps, CRC or inflammatory bowel disease)
Primary outcome(s): composition of gut microbiota;intestinal microbial phytase activity;16s rRNA metagenomic sequencing;diet surveys;phytic acid intake
Study Design: Case-Control study
| 2667847 | ecrin-mdr-crc
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO
Project description:To effectively monitor microbial populations in acidic environments and bioleaching systems, a comprehensive 50-mer-based oligonucleotide microarray was developed based on most of the known genes associated with the acidophiles. This array contained 1,072 probes in which there were 571 related to 16S rRNA and 501 related to functional genes. Acid mine drainage (AMD) presents numerous problems to the aquatic life and surrounding ecosystems. However, little is known about the geographic distribution, diversity, composition, structure and function of AMD microbial communities. In this study, we analyzed the geographic distribution of AMD microbial communities from twenty sites using restriction fragment length polymorphism (RFLP) analysis of 16S rRNA genes, and the results showed that AMD microbial communities were geographically distributed and had high variations among different sites. Then an AMD-specific microarray was used to further analyze nine AMD microbial communities, and showed that those nine AMD microbial communities had high variations measured by the number of detected genes, overlapping genes between samples, unique genes, and diversity indices. Statistical analyses indicated that the concentrations of Fe, S, Ca, Mg, Zn, Cu and pH had strong impacts on both phylogenetic and functional diversity, composition, and structure of AMD microbial communities. This study provides insights into our understanding of the geographic distribution, diversity, composition, structure and functional potential of AMD microbial communities and key environmental factors shaping them.
2011-03-08 | GSE27542 | GEO