Periphyllus koelreuteriae
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA1025156 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:To determine microbiota composition associated with loss of KDM5 in intestine, we carried out 16S rRNA seq analyses of dissected intestine from wildtype and kdm5 mutant. [GSM2628181-GSM2628190]. A total of 78 operational taxonomic units (OTUs) were identified in the sequence data. There were about 15 genera much less abundant in kdm5 mutant compared to wildtype. The kdm5 mutant were sensitive to pathogen. To confirm the microbiota associated with loss of KDM5 in intestine, 16S rRNA of new flies were sequenced and analyzed by Majorbio Bio-Pharm Technology Co. Ltd. (Shanghai, China) [GSM3243472-GSM3243481]. A total of 107 operational taxonomic units (OTUs) were identified in the sequence data. There were about 20 genera much less abundant in kdm5 mutant compared to wildtype. To confirm the microbiota associated with loss of KDM5 drosophila feeding with Lactobacillus plantarum, 16S rRNA of kdm5 mutant flies were sequenced and analyzed by Novogene Bioinformatics Technology Co., Ltd. (Tianjin, China) [GSM3263522-GSM3263527]. A total of 92 operational taxonomic units (OTUs) were identified in the sequence data. To confirm the microbiota associated with KDM5 knockdown in intestine, 16S rRNA of Myo1A-Gal4TS/+ and Myo1A-Gal4TS/+;+/kdm5RNAi flies were sequenced and analyzed by Biomarker Co. Ltd. (Beijing, China). [GSM3507915-GSM3507924]. A total of 50 operational taxonomic units (OTUs) were identified in the sequence data. There was a significant different based on the genus level between two groups.
2019-02-08 | GSE98944 | GEO
Project description:Morus alba L. Raw protein sequence reads and sequence
2024-02-08 | PXD049451 |
Project description:16S rRNA gene sequencing of colonic feces from mice fed regular chow, regular chow+nobiletin, high-fat diet or high-fat diet+nobiletin.
2022-05-06 | E-MTAB-11551 | biostudies-arrayexpress
Project description:Nitrate-reducing iron(II)-oxidizing bacteria are widespread in the environment contribute to nitrate removal and influence the fate of the greenhouse gases nitrous oxide and carbon dioxide. The autotrophic growth of nitrate-reducing iron(II)-oxidizing bacteria is rarely investigated and poorly understood. The most prominent model system for this type of studies is enrichment culture KS, which originates from a freshwater sediment in Bremen, Germany. To gain insights in the metabolism of nitrate reduction coupled to iron(II) oxidation under in the absence of organic carbon and oxygen limited conditions, we performed metagenomic, metatranscriptomic and metaproteomic analyses of culture KS. Raw sequencing data of 16S rRNA amplicon sequencing, shotgun metagenomics (short reads: Illumina; long reads: Oxford Nanopore Technologies), metagenome assembly, raw sequencing data of shotgun metatranscriptomes (2 conditions, triplicates) can be found at SRA in https://www.ncbi.nlm.nih.gov/bioproject/PRJNA682552. This dataset contains proteomics data for 2 conditions (heterotrophic and autotrophic growth conditions) in triplicates.
2021-05-17 | PXD023186 | Pride
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO
Project description:Here we report 16s rRNA data in gut microbiota of hepatocellular carcinoma (HCC) patients with HBV induced HCC (HBVC) and non-HBV induced HCC (NHBVC) compared with healthy volunteers. A total of 2047 operational taxonomic units (OTUs) were identified in the sequence data. Our data shows that the NHBVC patients harbor lower anti-inflammatory bacteria and more pro-inflammatory bacteria, while the HBVC patients harbor more anti-inflammatory bacteria.
2019-02-27 | GSE108847 | GEO
Project description:This experiment was designed to improve the percentage of miRNA mapping reads from sRNA library sequencing, by reducing the amount of one particularly abundant rRNA 30mer sequence.
2018-02-25 | GSE86313 | GEO
Project description:We found that mainstream cigarette smoking (4 cigarettes/day, 5 days/week for 2 weeks using Kentucky Research Cigarettes 3R4F) resulted in >20% decrease in the percentage of normal Paneth cell population in Atg16l1 T300A mice but showed minimal effect in wildtype littermate control mice, indicating that Atg16l1 T300A polymorphism confers sensitivity to cigarette smoking-induced Paneth cell damage. We performed 16S rRNA sequencing to identify potential microbiota changes associated with Paneth cell defect in Atg16l1 T300A mice exposed to cigarette smoking. Female mice were used at 4-5 weeks of age. Cigarette smoking was performed using smoking chamber with the dosage and schedule as described above. The fecal samples from the mice were collected for 16S rRNA sequencing analysis after completing 6 weeks of smoking.
2018-10-31 | E-MTAB-5717 | biostudies-arrayexpress
Project description:Iron-rich pelagic aggregates (iron snow) were collected directly onto silicate glass filters using an electronic water pump installed below the redoxcline. RNA was extracted and library preparation was done using the NEBNext Ultra II directional RNA library prep kit for Illumina. Data was demultiplied by GATC sequencing company and adaptor was trimmed by Trimgalore. After trimming, data was processed quality control by sickle and mRNA/rRNA sequences were sorted by SortmeRNA. mRNA sequences were blast against NCBI-non redundant protein database and the outputs were meganized in MEGAN to do functional analysis. rRNA sequences were further sorted against bacterial/archeal 16S rRNA, eukaryotic 18S rRNA and 10,000 rRNA sequences of bacterial 16S rRNA, eukaryotic 18S rRNA were subset to do taxonomy analysis.
2021-10-15 | E-MTAB-9686 | biostudies-arrayexpress
Project description:Ribosomes of Bacteroidia (formerly Bacteroidetes) fail to recognize Shine-Dalgarno (SD) sequences even though they harbor the anti-SD (ASD) of 16S rRNA. This is due to sequestration of the 3’ tail of 16S rRNA in a pocket formed by bS21, bS18, and bS6 on the 30S platform, which functionally occludes the ASD. Interestingly, in many Flavobacteriales, the gene encoding bS21, rpsU, contains an extended SD sequence. In this work, we present genetic and biochemical evidence that bS21 synthesis in Flavobacterium johnsoniae is autoregulated via a subpopulation of ribosomes that specifically lack bS21. Mutation or depletion of bS21 in the cell specifically increases translation of reporters with strong SD sequences, such as rpsU’-gfp. Purified ribosomes lacking bS21 (or its C-terminal region) exhibit higher rates of initiation on rpsU mRNA and lower rates of initiation on other (SD-less) mRNAs than control ribosomes. The mechanism of autoregulation depends on extensive pairing between mRNA and 16S rRNA, and exceptionally strong SD sequences, with predicted pairing free energies of < –13 kcal/mol, are characteristic of rpsU across the Bacteroidia. To our knowledge, this is the first example of biochemically-verified specialized ribosomes with a clear regulatory purpose.
2023-03-11 | PXD036353 | Pride