Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: 16S amplicon sequencing data (V3-V4) of soil, earthworm gut content and earthworm cast

PROVIDER: PRJNA1063260 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR27481200_1.fastq.gz	Fastqsanger.gz
	SRR27481200_2.fastq.gz	Fastqsanger.gz
	SRR27481201_1.fastq.gz	Fastqsanger.gz
	SRR27481201_2.fastq.gz	Fastqsanger.gz
	SRR27481202_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 264

Similar Datasets

First exploration of the altered microbial gut-lung axis in the pathogenesis of human refractory chronic cough

Project description:v3-v4 16S rRNA sequencing was used to characterize both gut and oral microbiota composition of RCC (refractory chronic cough) patients and matched healthy controls (HC). The groups are matched in age and gender.

2024-04-17 | GSE240646 | GEO

food fermentation metagenome

Project description:16S V3-V4 amplicon sequencing

| PRJDB9082 | ENA

7a75f7bd-831c-4b1a-9a69-e36963fb9e78 - samples

Project description:Amplicon sequencing from 45 samples - Amplicons of 16s v3-v4

| EGAD00001005027 | EGA

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

Evaluating the gut microbiota shifts caused by two diets based on ancient grains

Project description:Total DNA was extracted from stool specimens, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2022-08-24 | GSE206807 | GEO

Comparing the microbiota composition between Cocaine addicted and Healthy subjects and the corresponding shift caused by rTMS treatment.

Project description:Total DNA was extracted from saliva and stool of the patients, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2023-05-31 | GSE206765 | GEO

Project description:V3-V4 16S rRNA Amplicon based Sequencing of ZT soil

| PRJNA927346 | ENA

Project description:V3-V4 16S rRNA Amplicon based Sequencing of ZT soil

| PRJNA928083 | ENA

Project description:V3-V4 16S rRNA Amplicon based Sequencing.

| PRJNA915093 | ENA

Project description:V3-V4 16S rRNA Amplicon based Sequencing.

| PRJNA915108 | ENA