Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

BRD4 ChIP-Seq in 22Rv1 cells exogenously expressing HNF4G or GFP

ABSTRACT: BRD4 ChIP-Seq in 22Rv1 cells exogenously expressing HNF4G or GFP

PROVIDER: PRJNA1072116 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Similar Datasets

BRD4 ChIP-Seq in 22Rv1 cells exogenously expressing HNF4G or GFP

Project description:BRD4 ChIP-Seq in 22Rv1 cells exogenously expressing HNF4G or GFP

2025-01-18 | GSE254869 | GEO

Expression profile of 22Rv1 cells with GFP or HNF4G exogenous expression when treated with BETi ABBV-075

Project description:To study the consequence of HNF4G target genes expression with ABBV-075 treatment in cells that have BETi-independent HNF4G expression, we performed RNA-Seq on 22Rv1 cells that exogenously express HNF4G using GFP expression as control.

2025-01-18 | GSE254733 | GEO

Identification of exogenously expressed RBRP-GFP peptide

Project description:The exogenously expressed RBRP-GFP peptide encoded by lncRNA LINC00266-1 was validated by mass spectrometry.

2020-02-25 | PXD016267 |

HNF4G, AR, FOXA1, H3K4me1, H3K27acetyl binding sites upon knockdown and overexpression of HNF4G in 22Rv1 and LNCaP prostate cancer cells respectively

Project description:HNF4G is a gastrointestinal tissue enriched master transcriptional regulator seen overexpressed in a subset of prostate cancer. Here we have mapped binding sites of HNF4G, AR, Foxa1, H3K4me1, H3K27acetyl upon knockdown and overexpression of HNF4G in in 22Rv1 and LNCaP cells respectively

2017-11-01 | GSE85558 | GEO

Expression profile of 22Rv1 cells with GFP or HNF4G exogenous expression when treated with BETi ABBV-075

Project description:Expression profile of 22Rv1 cells with GFP or HNF4G exogenous expression when treated with BETi ABBV-075

| PRJNA1071591 | ENA

RNA sequencing in 22RV1 cells stably expressing shLuc, shIMPA1, shIMPDH2

Project description:We investigated gene expession profiles of IMPA1 knockdown and IMPDH2 knockdown in CRPC 22RV1 cells by using RNA-seq

2024-08-15 | GSE270564 | GEO

22Rv1 in vivo progression model

Project description:Purpose: Even in last stage of metastatic castration-resistant prostate cancer, androgen receptor (AR) signaling remains active.To derive high metastatic prostate cancer (PCa), we labeled AR-positive but castration-resistant 22Rv1 PCa cells with luciferase gene (22Rv1-Luc2) and these cells were orthotopically implanted in mouse prostate for spontaneous progression. Methods: 2 × 10^5 of luciferase-expressing 22Rv1 cells (22Rv1-Luc2) cells were implanted in the anterior prostate of nude mice. After 12-14 weeks, the host mice were necropsied and the metastases from lumbar lymph nodes and primary tumors were dissected under laminar flow. Tumor tissues were minced using sterile scalpels and further digested with Collagenase D for 1 h. The lymph node metastatic cancer cells, named 22Rv1-M1, were orthotopically reimplanted in nude mice. At 12 weeks, the secondary metastases were isolated in the lumbar lymph nodes and designated as 22Rv1-M2 cells. Suspension of 1 × 10^6 22Rv1-M2 cells in DPBS was injected into nude mice through the tail vein, and mice developed metastases (22Rv1-M3) after 6 week. This procedure was repeated once to attain the 22Rv1-M4. Results: 22Rv1-derived metastatic cell lines exhibit increased in vitro and in vivo invasion activity as the progression from 22Rv1 to M4. Transcriptomic analysis of genome-wide gene expression in the M4 tumors reveal the unique gene expression profile compared to 22Rv1 tumors. Conclusions: Transcriptomic data provide the gene network for decoding the mechanism of PCa metastasis.

2017-12-01 | GSE99857 | GEO

Gene expression profile of doxycycline inducible shHNF4G hairpins in 22RV1 prostate cancer cells

Project description:To determine genes regulated by HNF4G, we performed doxycycline induced shRNA mediated knockdown of HNF4G using two lentiviral constructs as well as a scrambled shRNA in duplicate. Two pLKO.1 constructs against HNF4G (HNF4Gsh1: TRCN0000019243, targeting CACCAGCATCTCTCCAAACAA in coding DNA sequence (CDS); and HNF4Gsh2: TRCN0000420190, targeting GATGAGCTGGTTAGACCATTTC in CDS) were purchased from Sigma Aldrich MISSION® shRNA Plasmid DNA and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after doxycycline treatment and gene expression profiling was performed.

2017-11-01 | GSE85242 | GEO

RNAseq of GFP-sorted cells (Low-GFP vs. High-GFP, GFP-fed vs GFP+fed)

Project description:RNAseq of GFP-sorted cells (Low-GFP vs. High-GFP, GFP-fed vs GFP+fed)

| PRJNA544322 | ENA

RNA sequencing in 22RV1 cells stably expressing shLuc, shIMPA1, shIMPDH2

Project description:RNA sequencing in 22RV1 cells stably expressing shLuc, shIMPA1, shIMPDH2

| PRJNA1127502 | ENA