Ontology highlight
ABSTRACT:
PROVIDER: PRJNA1072618 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR27877281_1.fastq.gz | Fastqsanger.gz | |||
| SRR27877281_2.fastq.gz | Fastqsanger.gz | |||
| SRR27877282_1.fastq.gz | Fastqsanger.gz | |||
| SRR27877282_2.fastq.gz | Fastqsanger.gz | |||
| SRR27877283_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 10 |
Similar Datasets
Project description:A key limitation of the commonly-used CRISPR enzyme S. pyogenes Cas9 is the strict requirement of an NGG protospacer-adjacent motif (PAM) at the target site, which reduces the number of accessible genomic loci. This constraint can be limiting for genome editing applications that require precise Cas9 positioning. Recently, two Cas9 variants with a relaxed PAM requirement (NG) have been developed (xCas9 and Cas9-NG) but their activity has been measured at only a small number of endogenous sites. Here we devised a high-throughput Cas9 pooled competition screen to compare the performance of both PAM-flexible Cas9 variants and wild-type Cas9 at thousands of genomic loci and across 3 modalities (gene knock-out, transcriptional activation and suppression). We show that PAM flexibility comes at a substantial cost of decreased DNA targeting and cutting. Of the PAM-flexible variants, we found that Cas9-NG outperforms xCas9 regardless of genome engineering modality or PAM. Finally, we combined xCas9 mutations with those of Cas9-NG, creating a stronger transcriptional modulator than existing PAM-flexible Cas9 variants.
2020-01-26 | GSE143892 | GEO
Project description:We report the PAMs of AsCas12a using a cell-free TXTL-based cleavage assay. By adding randomized PAM library and AsCas12a-gRNA in vitro, functional PAM sequences were cleaved, while non-functional PAMs remained. By amplifying the non-cleaved DNA, we use next-generation sequencing to analyze the depletion of functional PAMs of AsCas12a.
2019-01-01 | GSE123443 | GEO
Project description:We report the PAMs of NmeCas9 using a cell-free TXTL-based cleavage assay. By adding randomized PAM library and NmeCas9-gRNA in vitro, functional PAM sequences were cleaved, while non-functional PAMs remained. By amplifying the non-cleaved DNA, we use next-generation sequencing to analyze the depletion of functional PAMs of NmeCas9.
2017-12-21 | GSE108357 | GEO
Project description:The clustered regularly interspaced short palindromic repeat (CRISPR)-associated enzyme Cas9 is an RNA-guided nuclease that has been widely adapted for genome editing in eukaryotic cells. However, the in vivo target specificity of Cas9 is poorly understood and most studies rely on in silico predictions to define the potential off-target editing spectrum. Using chromatin immunoprecipitation followed by sequencing (ChIP-seq), we delineate the genome-wide binding panorama of catalytically inactive Cas9 directed by two different single guide (sg) RNAs targeting the Trp53 locus. Cas9:sgRNA complexes are able to load onto multiple sites with short seed regions adjacent to 5’NGG3’ protospacer adjacent motifs (PAM). Examination of dmCas9 binding sites using two Trp53 targeting sgRNAs in Arf -/- MEF cell line (mouse).
2014-08-29 | E-GEOD-57650 | biostudies-arrayexpress
Project description:Randomized PAM depletion of AsCas12a
| PRJNA508763 | ENA
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress