Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: 16S-amplicon sequencing of mouse gastrointestinal contents

PROVIDER: PRJNA1112838 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR29067200_1.fastq.gz	Fastqsanger.gz
	SRR29067200_2.fastq.gz	Fastqsanger.gz
	SRR29067201_1.fastq.gz	Fastqsanger.gz
	SRR29067201_2.fastq.gz	Fastqsanger.gz
	SRR29067202_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 408

Similar Datasets

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

Experimental tests strongly challenge the evidence of a healthy human blood microbiome

Project description:The study critically evaluate the results of 16S targeted amplicon sequencing performed on the total DNA collected from healthy donors’ blood samples in the light of specific negative controls.

2024-03-01 | GSE254843 | GEO

Mouse caecum vs faeces - Metaproteogenomics Reveals Taxonomic and Functional Changes between Cecal and Fecal Microbiota in Mouse

Project description:We compared the microbiota of paired mouse caecal contents and faeces by applying a multi-omic approach, including 16S rDNA sequencing, shotgun metagenomics, and shotgun metaproteomics. The aim of the study was to verify whether faecal samples are a reliable proxy for the mouse colonic luminal microbiota, as well as to identify changes in taxonomy and functional activity between caecal and faecal microbial communities, which have to be carefully considered when using stool as sample for mouse gut microbiota investigations.

2017-03-31 | PXD004911 | Pride

Soil Metaproteomics LC-MS

Project description:Sensitive models of climate change impacts would require a better integration of multi-omics approaches that connect the abundance and activity of microbial populations. Here, we show that climate is a fundamental driver of the protein abundance of microbial populations (metaproteomics), yet not their genomic abundance (16S rRNA gene amplicon sequencing), supporting the hypothesis that metabolic activity may be more closely linked to climate than community composition.

2022-03-01 | PXD009773 | Pride

16S rDNA (v3-v4 region) sequencing of the cecal bacteria in control (CTL) and chronic nonbacterial prostatitis (CNP) rats

Project description:Prostate of SD rats was injected with 0.1 ml 1% carrageenan to induce chronic nonbacterial prostatitis, and the control rats injected with sterile saline. Then, the cecal contents were collected for 16S rDNA sequencing.

2021-07-07 | GSE179639 | GEO

Project description:16S amplicon of chicken cecum contents

| PRJNA647992 | ENA

16S rRNA amplicon sequencing of broiler caecal contents

Project description:16S rRNA amplicon sequencing of broiler caecal contents

| PRJEB33036 | ENA

Project description:16S sequencing of mouse cecal contents

| PRJNA1156993 | ENA

Project description:16S sequencing of mouse ileal contents

| PRJNA1039985 | ENA

Project description:16s sequencing of mouse colonic contents

| PRJNA860780 | ENA