Oryza sativa
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA115305 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:The small RNAs presented here were produced as a preliminary exploration of small RNAs in rice, and as such, various tissues and stress conditions were sampled. Small RNAs present in these samples were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. The datasets contain Oryza sativa var Nipponbar endogenous small RNA sequences in the size range 18 to 34 nt. Plants were grown in a Conviron Environmental Chamber at high light intensity using both high pressure sodium and metal halide lamps for 10.5 hr at 28 degrees C and for 13.5 hr at 26 degrees C in the dark. RNA was extracted from rice tissues at various stages of development and under different abiotic and biotic stresses. The small RNAs presented here were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682.
2009-06-08 | GSE16248 | GEO
Project description:In order to identify new miRNAs, NAT-siRNAs and possibly abiotic-stress regulated small RNAs in rice, three small RNA libraries were constructed from control rice seedlings and seedlings exposed to drought or salt stress, and then subjected to pyrosequencing.
2008-12-08 | GSE12317 | GEO
Project description:To address the role of small regulatory RNAs in rice development, we generated a large data set of small RNAs from root apices (RoApx), shoot apices (ShApx), developing inflorescence (Infl) and mature leaf (Leaf). These tissues were chosen because they are expected to be rich in small RNAs and display different patterns of small RNA expression. The RoApx, ShApx, and Infl samples are expected to be enriched for meristematic tissues each of which have different fates. The Infl sample would also be expected to contain developing female gametes. In contrast, the Leaf sample is terminally differentiated and may be expected to be more transcriptionally repressed. These small RNAs comprise a total of 781,885 distinct sequences, and all of these map to at least one locus of the rice genome TIGR version 5.
2009-06-08 | GSE16350 | GEO
Project description:Changes in patterns of gene expression are believed to be responsible for the phenotypic differences within and between species. Although the evolutionary significance of functional mutations has been emphasized in rice domestication, little is known about the differences in gene regulation underlying the phenotypic diversification among rice varieties. MicroRNAs (miRNAs) are small regulatory RNAs that play crucial roles in regulating post-transcriptional gene expression. Here, we studied the variation in the expression of both miRNAs and mRNA transcripts in three indica and three japonica rice varieties using RNA sequencing (RNA-seq) to examine the miRNA regulatory effect on target gene expression in rice. In total, 71.0%, 9.2%, and 1.5% of the expressed mature miRNAs showed tissue, subspecies, and tissue-subspecies interaction-biased expression. Most of these differentially expressed miRNAs are evolutionarily weakly conserved. To examine the miRNA regulatory effect on global gene expression under endogenous conditions, we performed pair-wise correlation coefficient analyses on the expression levels of 240 mature miRNAs and 1178 messenger RNAs (mRNAs) both globally and for each specific miRNA-mRNA pair. We found that the deeply conserved miRNAs can significantly decrease the target mRNA abundance. In addition, a total of 109 miRNA-mRNA pairs were identified as significantly correlated pairs (Adjusted p<0.01). Of those, 41 pairs showed positive correlations, while 68 pairs showed negative correlations. Functional analysis elucidated that these mRNAs belonged to different biological pathways that could regulate the stress response, metabolic processes, and rice development. In conclusion, the joint interrogation of miRNA and mRNA expression profiles in this study proved useful for the study of the role of miRNA expression and regulation in the plant transcriptome.
2017-02-09 | GSE71925 | GEO
Project description:In order to identify new miRNAs, NAT-siRNAs and possibly abiotic-stress regulated small RNAs in rice, three small RNA libraries were constructed from control rice seedlings and seedlings exposed to drought or salt stress, and then subjected to pyrosequencing. Totally three sets of small RNAs, which were obtained under normal condition as well as salt and drought stress conditions
2008-12-08 | E-GEOD-12317 | biostudies-arrayexpress
Project description:The small RNAs presented here were produced as a preliminary exploration of small RNAs in rice, and as such, various tissues and stress conditions were sampled. Small RNAs present in these samples were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. The datasets contain Oryza sativa var Nipponbar endogenous small RNA sequences in the size range 18 to 34 nt. Plants were grown in a Conviron Environmental Chamber at high light intensity using both high pressure sodium and metal halide lamps for 10.5 hr at 28 degrees C and for 13.5 hr at 26 degrees C in the dark. RNA was extracted from rice tissues at various stages of development and under different abiotic and biotic stresses. The small RNAs presented here were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. Run 1: A small RNA library was generated from whole cell RNA isolated from inflorescence, 30 and 60 day leaves, 10 and 25 day seedlings and from seedling polysomes using Bartel primers (5' ATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAAT 3'). This was combined with a library derived from whole cell RNA isolated from 30 and 60 day leaves and 10 and 25 day seedlings using Bartel A primers (5' AGCTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATACTG 3'). Run 2: Mixed tissues from unstressed plants. Library prepared from equal amounts of adult root, adult stem and inflorescence from unstressed plants. Amplified with Standard primers (5' ATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAAT 3'). Seedlings stressed by cold, salt desiccation, heat and dark. Tissues were mixed in a 2:2:1:1:1:1 ratio. Amplified with A primers (5' AGCTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATACTG 3'). Kinase library. RNA was isolated from tissues used in 'Adult whole plant' (~30%), 'Stressed' (~25%), from unstressed seedlings of various ages (~15%) from 30 and 60 day leaves (20%) and from immature inflorescence (~10%). RNA isolated from tissues from unstressed plants were treated with polynucleotide kinase before second ligation. This eliminates the dependence of a 5` phosphate as for all the other libraries. Amplified with B primers (5' CAGTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATAGCT 3').
2009-06-07 | E-GEOD-16248 | biostudies-arrayexpress
Project description:To address the role of small regulatory RNAs in rice development, we generated a large data set of small RNAs from root apices (RoApx), shoot apices (ShApx), developing inflorescence (Infl) and mature leaf (Leaf). These tissues were chosen because they are expected to be rich in small RNAs and display different patterns of small RNA expression. The RoApx, ShApx, and Infl samples are expected to be enriched for meristematic tissues each of which have different fates. The Infl sample would also be expected to contain developing female gametes. In contrast, the Leaf sample is terminally differentiated and may be expected to be more transcriptionally repressed. These small RNAs comprise a total of 781,885 distinct sequences, and all of these map to at least one locus of the rice genome TIGR version 5. Total RNA was extracted from root apices, shoot apices, developing inflorescence and mature leaf. Three samples from each tissue were taken to represent replicates and small RNAs from these were ligated to a common 5' RNA adapter and a replicate-specific 3' adapter. These replicate samples were then identified from within single 454 data sets using the 3' adapter sequence. It should be noted that there was a strong frequency bias observed between the RNA sequence and the particular 3' adapter used in the sequencing. This resulted in both increased or decreased read counts for the known miRNA sequences in a 3' adapter dependent fashion. Use of the three samples for each tissue as replicates is therefore problematic.
2009-06-07 | E-GEOD-16350 | biostudies-arrayexpress
Project description:MicroRNAs (miRNAs) and small interfering RNAs (siRNAs) regulate gene expression in eukaryotes. Plant miRNAs modulate their targets mainly via messenger RNA (mRNA) cleavage. Small RNA targets have been extensively investigated in Arabidopsis using computational prediction, experimental validation, and degradome sequencing. However, small RNA targets are largely unknown in rice (Oryza sativa). Here, we report global identification of small RNA targets using high throughput degradome sequencing in the rice indica cultivar 93-11 (Oryza sativa L. ssp. indica). 177 transcripts targeted by total of 87 unique miRNAs were identified. Of targets for the conserved miRNAs between Arabidopsis and rice, transcription factors comprise around 70% (58 in 82), indicating that these miRNAs act as masters of gene regulatory nodes in rice. In contrast, non-conserved miRNAs targeted diverse genes which provide more complex regulatory networks. In addition, 5 AUXIN RESPONSE FACTORS (ARF) cleaved by the TAS3 derived ta-siRNAs were also detected. A total of 40 sRNA targets were further validated via RNA ligase-mediated 5’ rapid amplification of cDNA ends (RLM 5’-RACE). Our degradome results present a detailed sRNA-target interaction atlas, which provides a guide for the study of the roles of sRNAs and their targets in rice.
2010-01-01 | GSE19050 | GEO