Ontology highlight
ABSTRACT:
PROVIDER: PRJNA1154805 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Small interfering RNAs (siRNAs) targeting ZC3H18 were purchased from Suzhou Hongxun Biotechnology Co., Ltd. (Suzhou, China), with an empty vector serving as the control (si-nc). ZC3H18 siRNA sequences were GGGGTGAGGGCTTCTGATCT and TCGTCGGAGTGATTATCTTCCT. These siRNAs were introduced into KYSE150 and ECA109 cells using DharmaFect1 (Suzhou Hongxun Biotechnology Co., Ltd., Suzhou, China).
2025-02-21 | GSE290209 | GEO
Project description:Secondary bacterial pneumonia following influenza infection is a significant cause of mortality worldwide. Upper respiratory tract pneumococcal carriage is important as both determinants of disease and population transmission. The immunological mechanisms that contain pneumococcal carriage are well-studied in mice but remain unclear in humans. Loss of this control of carriage following influenza infection is associated with secondary bacterial pneumonia during seasonal and pandemic outbreaks. We used a human type 6B pneumococcal challenge model to show that carriage acquisition induces early degranulation of resident neutrophils and recruitment of monocytes to the nose. Monocyte function associated with clearance of pneumococcal carriage. Prior nasal infection with live attenuated influenza virus induced inflammation, impaired innate function and altered genome-wide nasal gene responses to pneumococcal carriage. Levels of the cytokine IP-10 promoted by viral infection at the time of pneumococcal encounter was positively associated with bacterial density. These findings provide novel insights in nasal immunity to pneumococcus and viral-bacterial interactions during co-infection.
2018-07-25 | GSE117580 | GEO
Project description:Between January 2021 and September 2021, a total of 5 pairs of adjacent normal tissues and CRC tumor tissues were collected at Suzhou Municipal Hospital. Written informed consent was secured from all participating patients prior to the commencement of the study. The study protocol, including all experiments, was reviewed and approved by the Ethics Committee of Suzhou Municipal Hospital.
2025-04-15 | E-MTAB-15000 | biostudies-arrayexpress
Project description:Corallococcus sp. NO1 Genome sequencing and assembly
| PRJDB16838 | ENA
Project description:Updated Annotation of the Parascedosporium putredinis NO1 Genome
| PRJEB60285 | ENA
Project description:Saccharina japonica cultivar HuangGuan No1 Assembly
| PRJNA941962 | ENA
Project description:Influenza A virus (IAV) predisposes individuals to secondary infections with the bacterium Streptococcus pneumoniae (the pneumococcus). Infections may manifest as pneumonia, sepsis, meningitis or otitis media (OM). It remains controversial as to whether secondary pneumococcal disease is due to the induction of an aberrant immune response or IAV induced immunosuppression. Moreover, as the majority of studies have been performed in the context of pneumococcal pneumonia, it remains unclear how far these findings can be extrapolated to other pneumococcal disease phenotypes. Here, we demonstrate that the viral hemagglutinin (HA) mediates bacterial OM by inducing a pro-inflammatory response in the middle ear cavity in a replication-dependent manner. Importantly, our findings show that it is the inflammatory response that mediates pneumococcal replication; not viral suppression of the immune system or epithelial damage. This study provide the first evidence that HA induced inflammation drives pneumococcal replication in the middle ear cavity, which has important consequences to the treatment of pneumococcal OM.
2013-01-01 | GSE41098 | GEO
Project description:Neisseria meningitidis in Suzhou Genome sequencing and assembly
| PRJNA1057752 | ENA
Project description:Alosa sapidissima isolate:Suzhou Genome sequencing and assembly
| PRJNA732845 | ENA