Project description:Small interfering RNAs (siRNAs) targeting ZC3H18 were purchased from Suzhou Hongxun Biotechnology Co., Ltd. (Suzhou, China), with an empty vector serving as the control (si-nc). ZC3H18 siRNA sequences were GGGGTGAGGGCTTCTGATCT and TCGTCGGAGTGATTATCTTCCT. These siRNAs were introduced into KYSE150 and ECA109 cells using DharmaFect1 (Suzhou Hongxun Biotechnology Co., Ltd., Suzhou, China).
Project description:Secondary bacterial pneumonia following influenza infection is a significant cause of mortality worldwide. Upper respiratory tract pneumococcal carriage is important as both determinants of disease and population transmission. The immunological mechanisms that contain pneumococcal carriage are well-studied in mice but remain unclear in humans. Loss of this control of carriage following influenza infection is associated with secondary bacterial pneumonia during seasonal and pandemic outbreaks. We used a human type 6B pneumococcal challenge model to show that carriage acquisition induces early degranulation of resident neutrophils and recruitment of monocytes to the nose. Monocyte function associated with clearance of pneumococcal carriage. Prior nasal infection with live attenuated influenza virus induced inflammation, impaired innate function and altered genome-wide nasal gene responses to pneumococcal carriage. Levels of the cytokine IP-10 promoted by viral infection at the time of pneumococcal encounter was positively associated with bacterial density. These findings provide novel insights in nasal immunity to pneumococcus and viral-bacterial interactions during co-infection.
Project description:Between January 2021 and September 2021, a total of 5 pairs of adjacent normal tissues and CRC tumor tissues were collected at Suzhou Municipal Hospital. Written informed consent was secured from all participating patients prior to the commencement of the study. The study protocol, including all experiments, was reviewed and approved by the Ethics Committee of Suzhou Municipal Hospital.
Project description:Thanks to surface digestion protocol above pneumococcal pediatric strains and in silico selection, we selected 94 pneumococcal proteins according to their surface-exposed domains and/or interactions with surface environment. Then, that proteins were cloned as recombinant form in Escherichia coli and face off to pediatric sera from control and pneumococcal patients.
