Project description:Primary objectives: The primary objective is to investigate circulating tumor DNA (ctDNA) via deep sequencing for mutation detection and by whole genome sequencing for copy number analyses before start (baseline) with regorafenib and at defined time points during administration of regorafenib for treatment efficacy in colorectal cancer patients in terms of overall survival (OS).
Primary endpoints: circulating tumor DNA (ctDNA) via deep sequencing for mutation detection and by whole genome sequencing for copy number analyses before start (baseline) with regorafenib and at defined time points during administration of regorafenib for treatment efficacy in colorectal cancer patients in terms of overall survival (OS).
Project description:Small interfering RNAs (siRNAs) targeting ZC3H18 were purchased from Suzhou Hongxun Biotechnology Co., Ltd. (Suzhou, China), with an empty vector serving as the control (si-nc). ZC3H18 siRNA sequences were GGGGTGAGGGCTTCTGATCT and TCGTCGGAGTGATTATCTTCCT. These siRNAs were introduced into KYSE150 and ECA109 cells using DharmaFect1 (Suzhou Hongxun Biotechnology Co., Ltd., Suzhou, China).
Project description:Multiomics of faecal samples collected from individuals in families with multiple cases of type 1 diabetes mellitus (T1DM) over 3 or 4 months. Metagenomic and metatranscriptomic sequencing and metaproteomics were carried out, as well as whole human genome sequencing. Phenotypic data is available.
Project description:Multiomics of faecal samples collected from individuals in families with multiple cases of type 1 diabetes mellitus (T1DM) over 3 or 4 months. Metagenomic and metatranscriptomic sequencing and metaproteomics were carried out, as well as whole human genome sequencing. Phenotypic data is available.