Ontology highlight
ABSTRACT:
PROVIDER: PRJNA1186829 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR31366418.fastq.gz | Fastqsanger.gz | |||
| SRR31366419.fastq.gz | Fastqsanger.gz | |||
| SRR31366420.fastq.gz | Fastqsanger.gz | |||
| SRR31366421.fastq.gz | Fastqsanger.gz | |||
| SRR31366422.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 54 |
Similar Datasets
Project description:Paramyxoviruses are negative sense single-stranded RNA viruses that comprise many important human and animal pathogens, including human parainfluenza viruses. These viruses bud from the plasma membrane of infected cells after the viral ribonucleoprotein complex (vRNP) is transported from the cytoplasm to the cell membrane via Rab11a marked recycling endosomes. The viral proteins that are critical for mediating this important initial step in viral assembly are unknown. Here we use the model paramyxovirus, murine parainfluenza virus 1, or Sendai virus (SeV), to investigate the roles of viral proteins in Rab11a-driven virion assembly. We previously reported that infection with SeV containing high levels of copy-back defective viral genomes (DVGs) generates heterogenous populations of cells, with cells enriched in full-length virus producing viral particles containing standard or defective viral genomes, while cells enriched in DVGs did not, despite high levels of defective viral genome replication. Here we take advantage of this heterogenous cell phenotype to identify proteins that mediate interaction of vRNPs with Rab11a. We examine the role of matrix protein and nucleoprotein and determine that they are not sufficient to drive interaction of vRNPs and recycling endosomes. Then, using a combination of mass spectrometry and comparative protein abundance and localization in DVG- and FL-high cells, we identify viral polymerase complex components L and, specifically, its cofactor C proteins as interactors with Rab11a. We find that accumulation of these proteins within the cell is the defining feature that differentiates cells that proceed to viral egress from cells which remain in replication phases. Paramyxoviruses are a family of viruses that include a number of pathogens with significant burdens on human health. Particularly, human parainfluenza viruses are an important cause of pneumonia and bronchiolitis in children and do not have any vaccines or direct acting antivirals. These cytoplasmic replicating viruses bud from the plasma membrane and coopt cellular endosomal recycling pathways to traffic viral ribonucleoprotein complexes from the cytoplasm to the membrane of infected cells, yet the viral proteins required for viral engagement with the recycling endosome pathway is not known. Here we use the model paramyxovirus Sendai virus, or murine parainfluenza virus 1, to investigate the role of viral proteins in this initial step in viral assembly. We find that viral polymerase components large protein L and accessory C proteins are necessary for engagement with recycling endosomes. These findings are important in identifying viral targets for the development of antivirals.
2020-08-06 | PXD019637 | Pride
Project description:Amplicon sequencing of diverse viruses with 3’ anchored primer clouds
| PRJEB81871 | ENA
Project description:Comparison of Mutations in Human Parainfluenza Viruses during Passage
| PRJDB18043 | ENA
Project description:Life-threatening pulmonary influenza can be caused by inborn errors of type I and III IFN immunity. We report a 5 year-old child with severe pulmonary influenza at 2 years. She is homozygous for a loss-of-function IRF9 allele. Her cells activate gamma-activated factor (GAF) STAT1 homodimers but not interferon-stimulated gene factor 3 (ISGF3) trimers (STAT1/STAT2/IRF9) in response to IFN-α2b. The transcriptome induced by IFN-α2b in the patient’s cells is much narrower than that of control cells; however, induction of a subset of interferon-stimulated gene transcripts remains detectable. In vitro, the patient’s cells do not control three respiratory viruses, influenza A virus (IAV), parainfluenza virus, and respiratory syncytial virus. These phenotypes are rescued by wild-type IRF9, whereas silencing IRF9 expression in control cells increases viral replication. However, the child has controlled various common viruses in vivo, including respiratory viruses other than IAV. Our findings show that human IRF9- and ISGF3-dependent type I and III IFN responsive pathways are essential for controlling IAV.
2018-08-06 | GSE117637 | GEO
Project description:Contaminated aquifer (Dusseldorf-Flinger, Germany) templates extracted from 5 sediment depths ranging between 6.4 and 8.4 m below ground and over 3 years of sampling were amplified for amplicon pyrosequencing using the primers Ba27f (5’-aga gtt tga tcm tgg ctc ag-3’) and Ba519r (5’- tat tac cgc ggc kgc tg-3’), extended as amplicon fusion primers with respective primer A or B adapters, key sequence and multiplex identifiers (MID) as recommended by 454/Roche. Amplicons were purified and pooled as specified by the manufacturer. Emulsion PCR (emPCR), purification of DNA-enriched beads and sequencing run were performed following protocols and using a 2nd generation pyrosequencer (454 GS FLX Titanium, Roche) as recommended by the developer. Quality filtering of the pyrosequencing reads was performed using the automatic amplicon pipeline of the GS Run Processor (Roche), with a slight modification concerning the valley filter (vfScanAllFlows false instead of TiOnly) to extract the sequences. Demultiplexed raw reads were furhter trimmed for quality and lenght (>250 bp).
2012-11-11 | GSE25345 | GEO
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.
2022-07-27 | GSE208665 | GEO
Project description:Human parainfluenza virus 1 Genome Sequencing
| PRJNA73053 | ENA
Project description:Human parainfluenza virus 3 Genome Sequencing
| PRJNA73055 | ENA
Project description:Primer modifications for next-generation amplicon sequencing
| PRJNA492144 | ENA