Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Metagenome

ABSTRACT: Primer modifications for next-generation amplicon sequencing

PROVIDER: PRJNA492144 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR7882810_1.fastq.gz	Fastqsanger.gz
	SRR7882810_2.fastq.gz	Fastqsanger.gz
	SRR7882820_1.fastq.gz	Fastqsanger.gz
	SRR7882820_2.fastq.gz	Fastqsanger.gz
	SRR7882830_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 276

Similar Datasets

Amplicon-based targeted re-sequencing analysis of target genes in human DNA samples using the Illumina TruSeq Custom Amplicon technology

Project description:Amplicon-based targeted re-sequencing analysis was performed in the patient-derived gliobastoma cell culture samples. For this purpose, genomic DNA (gDNA) was isolated and DNA libraries were prepared using the TruSeq Custom Amplicon Low Input (Illumina, Inc.) technology. By this, a pool of 375 amplicons was generated for each single sample in order to enrich for the target genes ATRX1, EGFR, IDH1, NF1, PDGFRA, PIK3CG, PIK3R1, PTEN, RB1 and TP53. Sequencing was performed on the Illumina MiSeq® next generation sequencing system (Illumina Inc.) and its 2 x 250 bp paired-end v2 read chemistry. The resulting reads were quality controlled and mapped against the human reference genome (hg19). For all samples, sequence variations of the amplified regions of interest in comparison to the human reference sequence were identified and filtered based on reliability.

2021-07-07 | E-MTAB-9343 | biostudies-arrayexpress

High-throughput 16S rRNA amplicon pyrosequencing of contaminated aquifer sediment

Project description:Contaminated aquifer (Dusseldorf-Flinger, Germany) templates extracted from 5 sediment depths ranging between 6.4 and 8.4 m below ground and over 3 years of sampling were amplified for amplicon pyrosequencing using the primers Ba27f (5’-aga gtt tga tcm tgg ctc ag-3’) and Ba519r (5’- tat tac cgc ggc kgc tg-3’), extended as amplicon fusion primers with respective primer A or B adapters, key sequence and multiplex identifiers (MID) as recommended by 454/Roche. Amplicons were purified and pooled as specified by the manufacturer. Emulsion PCR (emPCR), purification of DNA-enriched beads and sequencing run were performed following protocols and using a 2nd generation pyrosequencer (454 GS FLX Titanium, Roche) as recommended by the developer. Quality filtering of the pyrosequencing reads was performed using the automatic amplicon pipeline of the GS Run Processor (Roche), with a slight modification concerning the valley filter (vfScanAllFlows false instead of TiOnly) to extract the sequences. Demultiplexed raw reads were furhter trimmed for quality and lenght (>250 bp).

2012-11-11 | GSE25345 | GEO

Molecular Profiling to Improve Outcome of Patients in Cancer. A Pilot Study

Project description:Next Generation Sequencing in cancer: a feasibility study in France to assess sample circuit and to perform analyzes within a limited time.

| 2274538 | ecrin-mdr-crc

An RNA Polymerase Ribozyme that Synthesizes its Own Ancestor

Project description:As part of an examination of a newly-evolved RNA polymerase ribozyme, 38-6, products of primer extension experiments using an RNA template encoding the hammerhead RNA endonuclease ribozyme, using 38-6 and its less active ancestor 24-3. These products were analyzed by next-generation sequencing to determine the rates of substitution, deletion, and insertion mutations for both polymerases.

2019-12-17 | GSE142114 | GEO

High-throughput 16S rRNA amplicon pyrosequencing of contaminated aquifer sediment

2012-11-11 | E-GEOD-25345 | biostudies-arrayexpress

MultiEditR: The first tool for detection and quantification of multiple RNA editing sites from Sanger sequencing demonstrates comparable fidelity to RNA-seq

Project description:We present MultiEditR, the first algorithm specifically designed to detect and quantify RNA editing from Sanger sequencing (z.umn.edu/multieditr). Although RNA editing is routinely evaluated by measuring the heights of peaks from in Sanger sequencing traces, the accuracy and the precision of this approach has yet to be evaluated against gold-standards next-generation sequencing methods. Through a comprehensive comparison to RNA-seq and amplicon based deep sequencing, we show that MultiEditR is accurate, precise, and reliable for detecting endogenous and programmable RNA editing.

2023-01-04 | GSE164211 | GEO

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

ChIP-seq mapping of histone modifications in CD14++ CD16- monocytes from human blood samples

Project description:Chromatin immunoprecipitation in combination with a genome-wide analysis via high-throughput sequencing is the state of the art method to gain genome-wide representation of histone modification or transcription factor binding profiles. However, chromatin immunoprecipitation analysis in the context of human experimental samples is limited, especially in the case of blood cells. The typically extremely low yields of precipitated DNA are usually not compatible with library amplification for next generation sequencing. We developed a highly reproducible protocol to present a guideline from the first step of isolating monocytes from a blood sample to analyse the distribution of histone modifications in a genome-wide manner. ChIP-seq histone modifications in CD14++ CD16- monocytes from human blood samples

2014-09-01 | E-GEOD-54634 | biostudies-arrayexpress

Project description:SARS-CoV-2 amplicon based Next-generation sequencing

| PRJNA993399 | ENA

pig metagenome

Project description:Development of a prokaryotic universal primer for simultaneous analysis of Bacteria and Archaea using next-generation sequencing

| PRJDB2918 | ENA

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data