Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Soil metagenome

ABSTRACT: V4 16S rRNA gene sequence data (Illumina (MiSeq)), soil metagenome

PROVIDER: PRJNA1190324 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR31516600_1.fastq.gz	Fastqsanger.gz
	SRR31516600_2.fastq.gz	Fastqsanger.gz
	SRR31516601_1.fastq.gz	Fastqsanger.gz
	SRR31516601_2.fastq.gz	Fastqsanger.gz
	SRR31516602_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 96

Similar Datasets

soil metagenome

Project description:V3-V4 16S rRNA gene sequence data (Illumina (MiSeq)), soil metagenome

| PRJNA1190320 | ENA

Evaluating the gut microbiota shifts caused by two diets based on ancient grains

Project description:Total DNA was extracted from stool specimens, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2022-08-24 | GSE206807 | GEO

Comparing the microbiota composition between Cocaine addicted and Healthy subjects and the corresponding shift caused by rTMS treatment.

Project description:Total DNA was extracted from saliva and stool of the patients, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2023-05-31 | GSE206765 | GEO

Analysis of microbiota composition within breast tumor and healthy breast tissues in males and females

Project description:Total DNA was extracted from FFPE specimens of breast tumor and surrounding healthy tissue, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2023-06-14 | GSE212891 | GEO

Comparing the microbiota composition between HPV positive and negative patients with CRC

Project description:Total DNA was extracted from the stool of the patients, amplified to collect amplicons of variable V3–V4 regions (primers 341F and 805R) of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2023-10-15 | GSE216589 | GEO

Molecular changes in the maize roots transcriptome due to soil microbes

Project description:The association between soil microbes and plant roots is present in all natural and agricultural environments. Microbes can be beneficial, pathogenic, or neutral to the host plant development and adaptation to abiotic or biotic stresses. Progress in investigating the functions and changes in microbial communities in diverse environments have been rapidly developing in recent years, but the changes in root function is still largely understudied. The aim of this study was to determine how soil bacteria influence maize root transcription and microRNAs (miRNAs) populations in a controlled inoculation of known microbes over a defined time course. At each time point after inoculation of the maize inbred line B73 with ten bacterial isolates, DNA and RNA were isolated from roots. The V4 region of the 16S rRNA gene was amplified from the DNA and sequenced with the Illumina MiSeq platform. Amplicon sequencing of the 16S rRNA gene indicated that most of the microbes successfully colonized maize roots. The colonization was dynamic over time and varied with the specific bacterial isolate. Small RNA sequencing and mRNA-Seq was done to capture changes in the root transcriptome from 0.5 to 480 hours after inoculation. The transcriptome and small RNA analyses revealed epigenetic and transcriptional changes in roots due to the microbial inoculation. This research provides the foundational data needed to understand how plant roots interact with bacterial partners and will be used to develop predictive models for root response to bacteria.

2023-05-01 | GSE214656 | GEO

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

Microbial community structure and functions are resilient to metal pollution along two forest soil gradients

Project description:Despite the global importance of forests, it is virtually unknown how their soil microbial communities adapt at the phylogenetic and functional level to long term metal pollution. Studying twelve sites located along two distinct gradients of metal pollution in Southern Poland revealed that both community composition (via MiSeq Illumina sequencing of 16S rRNA genes) and functional gene potential (using GeoChip 4.2) were highly similar across the gradients despite drastically diverging metal contamination levels. Metal pollution level significantly impacted microbial community structure (p = 0.037), but not bacterial taxon richness. Metal pollution altered the relative abundance of specific bacterial taxa, including Acidobacteria, Actinobacteria, Bacteroidetes, Chloroflexi, Firmicutes, Planctomycetes and Proteobacteria. Also, a group of metal resistance genes showed significant correlations with metal concentrations in soil, although no clear impact of metal pollution levels on overall functional diversity and structure of microbial communities was observed. While screens of phylogenetic marker genes, such as 16S rRNA, provided only limited insight into resilience mechanisms, analysis of specific functional genes, e.g. involved in metal resistance, appeared to be a more promising strategy. This study showed that the effect of metal pollution on soil microbial communities was not straightforward, but could be filtered out from natural variation and habitat factors by multivariate statistical analysis and spatial sampling involving separate pollution gradients.

2014-07-22 | GSE59620 | GEO

a7bcbc51-217a-491f-808b-617da8eeca65 - samples

Project description:Fecal samples Illumina MiSeq 16S rRNA sequencing, V4 hypervariable region

| EGAD00001004106 | EGA

ena-DATASET-KULVIB-19-10-2018-12:35:21:241-524 - samples

Project description:16S rRNA gene sequencing with Illumina MiSeq (V4 hypervariable region)

| EGAD00001004406 | EGA