An integrative analysis of the SOX2 response program in glioblastoma
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA130651 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR065790.fastq.gz | Fastqsanger.gz | |||
| SRR065791.fastq.gz | Fastqsanger.gz | |||
| SRR065792.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 3 of 3 |
Similar Datasets
Project description:This SuperSeries is composed of the following subset Series: GSE23795: Chip-Seq analysis of Sox2 protein genome-wide DNA binding sites in glioma cancer cells GSE23838: Genes regulated by Sox2 in glioma cancer cell line Refer to individual Series
2011-01-10 | E-GEOD-23839 | biostudies-arrayexpress
Project description:A SOX2 engineered epigenetic silencer factor represses the glioblastoma genetic program
| PRJNA822807 | ENA
Project description:Overexpression of the transcription factor SRY-related box 2 (SOX2) is characteristic of Glioblastoma (GBM), yet its regulatory network in vivo is poorly understood. Using a human orthotopic tumor model of GBM for ChIP-Seq analysis, we mapped the SOX2 cistrome. Integrative analysis of SOX2 cistrome and GBM transcriptome data identified two transcription factors, oligodendrocyte lineage transcription factor 2 (OLIG2) and zinc finger E-box binding homeobox 1 (ZEB1) as critical SOX2 targets. Their expression is strongly correlated with SOX2 expression in clinical GBM specimens, and all three proteins are frequently co-expressed in primary Glioblastoma cells, even in the setting of EGFR intratumoral heterogeneity. Sox2, Olig2, and Zeb1 expression is activated by the oncogene EGFRvIII in a murine glioma model, and we demonstrate that co-expression of these transcription factors transforms tumor suppressor deficient astrocytes in the absence of an upstream oncogene and that the resulting tumors exhibit the major histopathological features of GBM.
2017-01-24 | GSE58345 | GEO
Project description:The pluripotency transcription factor SOX2 is essential for the maintenance of glioblastoma stem cells (GSC), which drive tumor growth and treatment resistance.To understand how SOX2 is regulated in GSCs, we utilized a proteomic approach and identified the E3 ubiquitin ligase TRIM26 as a direct SOX2-interacting protein. Unexpectedly, we found TRIM26 depletion decreased SOX2 protein levels and increased SOX2 polyubiquitination in patient-derived GSCs, suggesting TRIM26 promotes SOX2 protein stability. Accordingly, TRIM26 knockdown reduced SOX2 transcriptional activity, self-renewal capacity, and in vivo tumorigenicity in multiple GSC lines. Mechanistically, we found TRIM26, via its C-terminal PRYSPRY domain, but independent of its RING domain, stabilizes SOX2 protein by directly inhibiting the interaction of SOX2 with WWP2, which we identify as a bona fide SOX2 E3 ligase in GSCs. Our work identifies E3 ligase competition as a critical mechanism of SOX2 regulation, with functional consequences for GSC identity and maintenance.
2021-11-04 | PXD028933 | Pride
Project description:Glioblastoma multiforme (GBM) continues to have a dismal prognosis. Even though detailed information on the genetic aberrations in cell signaling and cell cycle checkpoint control is available, no effective targeted treatment has been developed. Despite the advanced molecular defects, glioblastoma cells may have remnants of normal growth inhibitory pathways, such as the bone morphogenetic protein (BMP) signaling pathway. We have evaluated the growth inhibitory effect of bone morphogenetic protein 4 (BMP4) across a broad spectrum of patient samples, using a panel of 40 human glioblastoma initiating cell (GIC) cultures. A wide range of responsiveness was observed. BMP4 response was positively correlated with a proneural mRNA expression profile, high SOX2 activity, and BMP4-dependent upregulation of genes associated with inhibition of the MAPK pathway, as demonstrated by gene set enrichment analysis (GSEA). BMP4 response in sensitive cells was mediated by the canonical BMP receptor pathway involving SMAD1/5 phosphorylation and SMAD4 expression. SOX2 was consistently down regulated in BMP4-treated cells. Forced expression of SOX2 attenuated the BMP4 response including a reduced upregulation om MAPK inhibitory genes, implying a functional relationship between SOX2 down regulation and responsiveness. The results show an extensive heterogeneity in BMP4 responsiveness among GICs, and identify a BMP4 sensitive subgroup, in which SOX2 is a mediator of the response.
2020-01-21 | GSE143934 | GEO
Project description:Making use of a previously described isogenic cancer stem cells and serum differentiated cultures we show that Sox2 controls developmental stated specific programs in glioblastoma. Glioblastoma cells were cultured as control and with SOX2 knockdown to identify the scope of SOX2 interactions. The SOX2 knockdown were accomplished using two knockdown technologies. The knockdown cells were compared to controls, early passage, and scrambled controls. For Sox2 knockdown in low passage 10% FBS cells, the following oligonucleotides targeting human SOX2 coding sequence, or non-silencing control sequence, were cloned into BLOCK-iT Pol II miR RNAi expression vectors (Invitrogen), before cell transfection into GBM monolayer cells using Lipofectamine-2000 (Invitrogen): Sox2miRNA1R:5’CCTGTGCATGGGCTGTCTGCGCTGTCAGTCAGTGGCCAAAACAGCGCAGATGCAGCCCATGCAC Sox2miRNA1F:5’TGCTGTGCATGGGCTGCATCTGCGCTGTTTTGGCCACTGACTGACAGCGCAGACAGCC Sox2miRNA2R:5’CCTGAACCCATGGAGAAGAGCCAGTCAGTCAGTGGCCAAAACTGGCTCTTGGCTCCATGGGTTC Sox2miRNA2F:5’TGCTGAACCCATGGAGCCAAGAGCCAGTTTTGGCCACTGACTGACTGGCTCTTCTCCATGGGTT miRNAnegative:5’GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT Sox2 knockdown in neurospheres: GIPZ Lentiviral shRNAmir constructs targeting human Sox2 (clones V3LHS_404430 and V3LHS_404432) and non-silencing control (RHS4346) were obtained (Thermo Scientific Open Biosystems) and lentivirus were prepared according to the manufacturer’s instructions. Sox2 ectopic expression: Sox2 cDNA was subcloned from pCMV6-XL5-NM_002106.2 (Origene) into pcDNA 3.1 mammalian expression vector (Invitrogen), under control of constitutive CMV promoter. Plasmid DNA constructs were stably transfected into GBM monolayer cells using Lipofectamine-2000 (Invitrogen). Control Glioblastoma cells cultured as neurospheres and monolayer early passage are compared to multiple shRNA SOX2 knockdown and multiple miR knockdown cell cultures. A total of 8 samples are analyzed for significant fold change genes identifying gene-gene interactions associated with the SOX2 knockdown. High fold change genes are grouped in lists to be analyzed for network-pathway enrichment. Overlap of significant gene list for each method were analyzed.
2014-07-22 | E-GEOD-51441 | biostudies-arrayexpress
Project description:This SuperSeries is composed of the SubSeries listed below.
2011-01-10 | GSE23839 | GEO
Project description:Making use of a previously described isogenic cancer stem cells and serum differentiated cultures we show that Sox2 controls developmental stated specific programs in glioblastoma. Glioblastoma cells were cultured as control and with SOX2 knockdown to identify the scope of SOX2 interactions. The SOX2 knockdown were accomplished using two knockdown technologies. The knockdown cells were compared to controls, early passage, and scrambled controls. For Sox2 knockdown in low passage 10% FBS cells, the following oligonucleotides targeting human SOX2 coding sequence, or non-silencing control sequence, were cloned into BLOCK-iT Pol II miR RNAi expression vectors (Invitrogen), before cell transfection into GBM monolayer cells using Lipofectamine-2000 (Invitrogen): Sox2miRNA1R:5’CCTGTGCATGGGCTGTCTGCGCTGTCAGTCAGTGGCCAAAACAGCGCAGATGCAGCCCATGCAC Sox2miRNA1F:5’TGCTGTGCATGGGCTGCATCTGCGCTGTTTTGGCCACTGACTGACAGCGCAGACAGCC Sox2miRNA2R:5’CCTGAACCCATGGAGAAGAGCCAGTCAGTCAGTGGCCAAAACTGGCTCTTGGCTCCATGGGTTC Sox2miRNA2F:5’TGCTGAACCCATGGAGCCAAGAGCCAGTTTTGGCCACTGACTGACTGGCTCTTCTCCATGGGTT miRNAnegative:5’GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT Sox2 knockdown in neurospheres: GIPZ Lentiviral shRNAmir constructs targeting human Sox2 (clones V3LHS_404430 and V3LHS_404432) and non-silencing control (RHS4346) were obtained (Thermo Scientific Open Biosystems) and lentivirus were prepared according to the manufacturer’s instructions. Sox2 ectopic expression: Sox2 cDNA was subcloned from pCMV6-XL5-NM_002106.2 (Origene) into pcDNA 3.1 mammalian expression vector (Invitrogen), under control of constitutive CMV promoter. Plasmid DNA constructs were stably transfected into GBM monolayer cells using Lipofectamine-2000 (Invitrogen).
2014-07-22 | GSE51441 | GEO
Project description:By rational engineering of the transcription factor SOX2, a key promoter of GBM malignancy, we generated a synthetic repressor named SOX2 Epigenetic Silencer (SES), which maintains the ability to bind to a large group of its original targets. Data from RNAseq, ATACseq, MeDIPseq, ChIPseq in GBM cells indicate that SES, through the KRAB and DNA methyltransferase 3A/L catalytic domains, epigenetically inhibits the SOX2 tumorigenic molecular network (rather than activating it as SOX2 does). This epigenetic long-term transcriptional silencing includes genes crucial for tumor maintenance and growth. Conversely, transcriptomic and epigenomic data show that SES is ineffective (thus not harmful) in healthy neural cells.
2022-08-10 | GSE200062 | GEO
Project description:Sox2 has been studied in several types of human solid tumors. The investigators found that Sox2 had higher expression level in colorectal cancer and metastatic tissues than normal tissues. So the investigators assumed that whether Sox2 plays an important role in the progression and migration of colon cancer.
| 2124687 | ecrin-mdr-crc