A SOX2 engineered epigenetic silencer factor represses the glioblastoma genetic program
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA822807 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:By rational engineering of the transcription factor SOX2, a key promoter of GBM malignancy, we generated a synthetic repressor named SOX2 Epigenetic Silencer (SES), which maintains the ability to bind to a large group of its original targets. Data from RNAseq, ATACseq, MeDIPseq, ChIPseq in GBM cells indicate that SES, through the KRAB and DNA methyltransferase 3A/L catalytic domains, epigenetically inhibits the SOX2 tumorigenic molecular network (rather than activating it as SOX2 does). This epigenetic long-term transcriptional silencing includes genes crucial for tumor maintenance and growth. Conversely, transcriptomic and epigenomic data show that SES is ineffective (thus not harmful) in healthy neural cells.
2022-08-10 | GSE200062 | GEO
Project description:This SuperSeries is composed of the following subset Series: GSE23795: Chip-Seq analysis of Sox2 protein genome-wide DNA binding sites in glioma cancer cells GSE23838: Genes regulated by Sox2 in glioma cancer cell line Refer to individual Series
2011-01-10 | E-GEOD-23839 | biostudies-arrayexpress
Project description:The pluripotency transcription factor SOX2 is essential for the maintenance of glioblastoma stem cells (GSC), which drive tumor growth and treatment resistance.To understand how SOX2 is regulated in GSCs, we utilized a proteomic approach and identified the E3 ubiquitin ligase TRIM26 as a direct SOX2-interacting protein. Unexpectedly, we found TRIM26 depletion decreased SOX2 protein levels and increased SOX2 polyubiquitination in patient-derived GSCs, suggesting TRIM26 promotes SOX2 protein stability. Accordingly, TRIM26 knockdown reduced SOX2 transcriptional activity, self-renewal capacity, and in vivo tumorigenicity in multiple GSC lines. Mechanistically, we found TRIM26, via its C-terminal PRYSPRY domain, but independent of its RING domain, stabilizes SOX2 protein by directly inhibiting the interaction of SOX2 with WWP2, which we identify as a bona fide SOX2 E3 ligase in GSCs. Our work identifies E3 ligase competition as a critical mechanism of SOX2 regulation, with functional consequences for GSC identity and maintenance.
2021-11-04 | PXD028933 | Pride
Project description:Coordinate expression of the somatic cell reprogramming factors Oct4, Sox2, Klf4 and c-Myc within embryonic stem cells preserves the self-renewal of these cells, while allowing for the expression epitope tagged Sox2. Taking advantage of this observation, we engineered embryonic stem cells (i-OSKM-ESC) to inducibly express Oct4, Klf4, c-Myc and an epitope tagged form of Sox2 from a polycistronic element, in the presence of doxycycline. We isolated Sox2 and its associated protein complexes by co-immunoprecipitation. Subsequently, we identified the Sox2-protein interactome in self-renewing embryonic stem cells using an unbiased proteomic screen (Multidimensional Protein Identification Technology [MudPIT]). Affymetrix microarrays were used to characterize the gene expression profile of i-OSKM-ESC in the absence and presence of doxycycline. Mouse embryonic stem cells (KH2) were engineered to express Oct4, epitope tagged Sox2, Klf4 and c-Myc in the presence of doxycyline, to produce i-OSKM-ESC. The i-OSKM-ESC were cultured in the absence or presence of doxycyline (4 µg/mL) for 24 hours. RNA was extracted from each condition, and used for microarray analysis.
2012-02-20 | E-GEOD-34801 | biostudies-arrayexpress
Project description:Induction of the transcription factor Sox2 from a doxycycline-inducible promoter in iSox2-DAOY medulloblastoma cells. Affymetrix microarrays were used to characterize the gene expression profile of iSox2-DAOY cells in the absence and presence of doxycycline. Human DAOY medulloblastoma cells were engineered to express epitope tagged Sox2 under the control of a doxycycline inducible promoter, to produce iSox2-DAOY cells. iSox2-DAOY cells were FACS sorted into CD133 low and high populations. The CD133 low population was cultured in the absence and presence of 0.5 µg/mL doxycycline for 24 hours. RNA was extracted from cells cultured without and with doxycycline, and was used for microarray analysis.
2012-08-25 | E-GEOD-36947 | biostudies-arrayexpress
Project description:Sox2 has been studied in several types of human solid tumors. The investigators found that Sox2 had higher expression level in colorectal cancer and metastatic tissues than normal tissues. So the investigators assumed that whether Sox2 plays an important role in the progression and migration of colon cancer.
| 2124687 | ecrin-mdr-crc
Project description:An integrative analysis of the SOX2 response program in glioblastoma
| PRJNA130651 | ENA
Project description:Coordinate expression of the somatic cell reprogramming factors Oct4, Sox2, Klf4 and c-Myc within embryonic stem cells preserves the self-renewal of these cells, while allowing for the expression epitope tagged Sox2. Taking advantage of this observation, we engineered embryonic stem cells (i-OSKM-ESC) to inducibly express Oct4, Klf4, c-Myc and an epitope tagged form of Sox2 from a polycistronic element, in the presence of doxycycline. We isolated Sox2 and its associated protein complexes by co-immunoprecipitation. Subsequently, we identified the Sox2-protein interactome in self-renewing embryonic stem cells using an unbiased proteomic screen (Multidimensional Protein Identification Technology [MudPIT]). Affymetrix microarrays were used to characterize the gene expression profile of i-OSKM-ESC in the absence and presence of doxycycline.
2012-02-20 | GSE34801 | GEO
Project description:Making use of a previously described isogenic cancer stem cells and serum differentiated cultures we show that Sox2 controls developmental stated specific programs in glioblastoma. Glioblastoma cells were cultured as control and with SOX2 knockdown to identify the scope of SOX2 interactions. The SOX2 knockdown were accomplished using two knockdown technologies. The knockdown cells were compared to controls, early passage, and scrambled controls. For Sox2 knockdown in low passage 10% FBS cells, the following oligonucleotides targeting human SOX2 coding sequence, or non-silencing control sequence, were cloned into BLOCK-iT Pol II miR RNAi expression vectors (Invitrogen), before cell transfection into GBM monolayer cells using Lipofectamine-2000 (Invitrogen): Sox2miRNA1R:5’CCTGTGCATGGGCTGTCTGCGCTGTCAGTCAGTGGCCAAAACAGCGCAGATGCAGCCCATGCAC Sox2miRNA1F:5’TGCTGTGCATGGGCTGCATCTGCGCTGTTTTGGCCACTGACTGACAGCGCAGACAGCC Sox2miRNA2R:5’CCTGAACCCATGGAGAAGAGCCAGTCAGTCAGTGGCCAAAACTGGCTCTTGGCTCCATGGGTTC Sox2miRNA2F:5’TGCTGAACCCATGGAGCCAAGAGCCAGTTTTGGCCACTGACTGACTGGCTCTTCTCCATGGGTT miRNAnegative:5’GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT Sox2 knockdown in neurospheres: GIPZ Lentiviral shRNAmir constructs targeting human Sox2 (clones V3LHS_404430 and V3LHS_404432) and non-silencing control (RHS4346) were obtained (Thermo Scientific Open Biosystems) and lentivirus were prepared according to the manufacturer’s instructions. Sox2 ectopic expression: Sox2 cDNA was subcloned from pCMV6-XL5-NM_002106.2 (Origene) into pcDNA 3.1 mammalian expression vector (Invitrogen), under control of constitutive CMV promoter. Plasmid DNA constructs were stably transfected into GBM monolayer cells using Lipofectamine-2000 (Invitrogen). Control Glioblastoma cells cultured as neurospheres and monolayer early passage are compared to multiple shRNA SOX2 knockdown and multiple miR knockdown cell cultures. A total of 8 samples are analyzed for significant fold change genes identifying gene-gene interactions associated with the SOX2 knockdown. High fold change genes are grouped in lists to be analyzed for network-pathway enrichment. Overlap of significant gene list for each method were analyzed.
2014-07-22 | E-GEOD-51441 | biostudies-arrayexpress
Project description:Making use of a previously described isogenic cancer stem cells and serum differentiated cultures we show that Sox2 controls developmental stated specific programs in glioblastoma. Glioblastoma cells were cultured as control and with SOX2 knockdown to identify the scope of SOX2 interactions. The SOX2 knockdown were accomplished using two knockdown technologies. The knockdown cells were compared to controls, early passage, and scrambled controls. For Sox2 knockdown in low passage 10% FBS cells, the following oligonucleotides targeting human SOX2 coding sequence, or non-silencing control sequence, were cloned into BLOCK-iT Pol II miR RNAi expression vectors (Invitrogen), before cell transfection into GBM monolayer cells using Lipofectamine-2000 (Invitrogen): Sox2miRNA1R:5’CCTGTGCATGGGCTGTCTGCGCTGTCAGTCAGTGGCCAAAACAGCGCAGATGCAGCCCATGCAC Sox2miRNA1F:5’TGCTGTGCATGGGCTGCATCTGCGCTGTTTTGGCCACTGACTGACAGCGCAGACAGCC Sox2miRNA2R:5’CCTGAACCCATGGAGAAGAGCCAGTCAGTCAGTGGCCAAAACTGGCTCTTGGCTCCATGGGTTC Sox2miRNA2F:5’TGCTGAACCCATGGAGCCAAGAGCCAGTTTTGGCCACTGACTGACTGGCTCTTCTCCATGGGTT miRNAnegative:5’GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT Sox2 knockdown in neurospheres: GIPZ Lentiviral shRNAmir constructs targeting human Sox2 (clones V3LHS_404430 and V3LHS_404432) and non-silencing control (RHS4346) were obtained (Thermo Scientific Open Biosystems) and lentivirus were prepared according to the manufacturer’s instructions. Sox2 ectopic expression: Sox2 cDNA was subcloned from pCMV6-XL5-NM_002106.2 (Origene) into pcDNA 3.1 mammalian expression vector (Invitrogen), under control of constitutive CMV promoter. Plasmid DNA constructs were stably transfected into GBM monolayer cells using Lipofectamine-2000 (Invitrogen).
2014-07-22 | GSE51441 | GEO