Escherichia coli
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA138813 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Strains devoid of ppGpp (ΔrelA ΔspoT; called ppGpp0), and ppGpp0 dksA- exhibit several amino acid requirements for growth on minimal media. We found that overexpression of DksA can complement some of those requirements. Since DksA is a factor that binds to the RNA polymerase secondary channel, we wondered if other secondary channel proteins might also exert a similar role with respect to growth on minimal media. In our study we found that GreA and partially GreB can in fact complement these requirements under certain conditions. Here, we wished to investigate a broader effect of GreA and GreB on ppGpp0 and ppGpp0 dksA- strains. Since the parent strains are unable to grow in minimal media, we had to supplement the M9 glucose medium with a set of amino acids (DFHILQSTV). We found that both, GreA and GreB can affect a much larger set of genes in the absence of dksA, than in its presence. Also, GreA seems to affect more genes than GreB, under both conditions. We used microarrays to detail the effects of overproducing either GreA or GreB in cells devoid of ppGpp, in the dksA+ or dksA- background E. coli cells harbouring plasmids carrying either greA (pA = pHM1873) or greB (pB = pHM1874) genes, or vector control (pGB2), were monitored in an effort to elucidate the effects of their protein products. This was done in two backgrounds- either in E. coli ppGpp0 cells (ΔrelA, ΔspoT) carrying wt dksA gene or a dksA deletion.
2011-10-26 | E-GEOD-28795 | biostudies-arrayexpress
Project description:Strains devoid of ppGpp (ΔrelA ΔspoT; called ppGpp0), and ppGpp0 dksA- exhibit several amino acid requirements for growth on minimal media. We found that overexpression of DksA can complement some of those requirements. Since DksA is a factor that binds to the RNA polymerase secondary channel, we wondered if other secondary channel proteins might also exert a similar role with respect to growth on minimal media. In our study we found that GreA and partially GreB can in fact complement these requirements under certain conditions. Here, we wished to investigate a broader effect of GreA and GreB on ppGpp0 and ppGpp0 dksA- strains. Since the parent strains are unable to grow in minimal media, we had to supplement the M9 glucose medium with a set of amino acids (DFHILQSTV). We found that both, GreA and GreB can affect a much larger set of genes in the absence of dksA, than in its presence. Also, GreA seems to affect more genes than GreB, under both conditions. We used microarrays to detail the effects of overproducing either GreA or GreB in cells devoid of ppGpp, in the dksA+ or dksA- background
2011-10-27 | GSE28795 | GEO
Project description:Inorganic polyphosphate (polyP) is synthesized by bacteria in response to various stresses, but the mechanism of its regulation is unknown. Mutants of Escherichia coli lacking the RNA polymerase-binding transcription factor dksA are defective in polyP synthesis after a nutrient limitation stress, and this defect is reversed in a dksA greA mutant. In this work, we used RNA sequencing to compare transcription in wild-type, dksA, and dksA greA strains of E. coli before and after nutrient limitation, to identify genes whose expression pattern correlates with ability to synthesize polyP.
2020-03-11 | GSE144816 | GEO
Project description:Purpose: We investigated how deletion of DksA or ppGpp, two E. coli global transcription regulators, affects T4 infection. Method: B606, B606 DdksA, and B606 ppGpp0 were grown at 37C to early/mid log phase (OD600 ~ 0.4) then infected with moi of 10 of either wt T4 or T4motAam and total RNA was isolated. 2.5 µg total RNA from each sample was treated with a Ribo-Zero rRNA Removal Kit (Gram-Negative Bacteria; Illumina San Diego, CA) to deplete rRNA. The enriched mRNA was fragmented, reverse-transcribed, ligated with dual indexes, and amplified using a TruSeq Stranded mRNA Library Prep Kit (Illumina, San Diego, CA). The resulting RNA-Seq libraries were pooled at equal concentrations and sequenced using on an Illumina MiSeq to generate 2 x 100 bp paired-end reads. Read data in fastq format was demultiplexed and aligned to E. coli B str. DE3 (NC_012971.2) reference genome using STAR v2.5.2, retaining unmapped reads (Dobin, Davis et al. 2013). Unmapped reads were then mapped in a second step to T4 reference (NC_000866.4). In both cases, default alignment behavior was altered with the following arguments: --outFilterScoreMinOverLread 0 --outFilterMatchNmin 30 --outFilterMatchNminOverLread 0 --clip3pAdapterSeq AGATCGGAAGAGCGTCGTGTA --alignIntronMax 1. RNA gene counts in both reference genomes were then quantified using the same NCBI gene definitions utilized in mapping index construction using the subread featureCounts v1.4.6-p3 package (Liao, Smyth et al. 2014). Differential expression between samples fchanges in gene expression was predetermined to entail a fold change of more than or equal to 2 and P value less than or equal to 0.05. at 5 minutes post-infection. Result: Both ppGpp0 and delta(dksA) increase wt T4 plaque size. However, ppGpp0 does not significantly alter burst size/latent period and only modestly affects T4 transcript abundance, while delta(dskA) increases burst size (2-fold), does not affect latent period, and increases the abundance of several Pe RNAs at 5 min post-transcription. delta(dskA) also increases T4motAam plaque size with a much shorter latent period compared to T4motAam/wt infection, and the levels of specific middle RNAs increase due to more transcription from Pe's that extend into these middle genes. Conclusion: We conclude that DksA attenuates T4 early gene expression. Consequently, delta(dksA) results in a more productive wt infection and ameliorates the poor expression of middle genes in a T4motAam infection.
2018-03-15 | GSE111808 | GEO
Project description:Expression profiles of wild-type and SgrR mutant E. coli strains under aMG and 2-DG-induced stress. Expression profiles of E. coli overexpressing SgrS sRNA.
2013-03-26 | GSE45443 | GEO
Project description:Expression data from E. coli cells overexpressing GraL for short periods of time
| PRJNA123245 | ENA
Project description:Expression data from E. coli cells overexpressing GraL for long periods of time
| PRJNA123247 | ENA
Project description:S. Typhimurium parent, ppGpp0 and dksA strains were grown to OD's of 2.3 (ESP) and 4.2 (LSP) and subjected to ChIP-chip analysis at 60 nt resolution.
2015-05-31 | GSE63711 | GEO
Project description:Expression profiles of wild-type and SgrR mutant E. coli strains under aMG and 2-DG-induced stress. Expression profiles of E. coli overexpressing SgrS sRNA. Illumina RNA-Seq of total RNA extracted from wild-type, SgrR/SgrS mutant and SgrS overexpressing E. coli strains grown in different conditions.
2013-03-26 | E-GEOD-45443 | biostudies-arrayexpress
Project description:We uncovered evidence for an expanded role of transcription-coupled repair factor Mfd in Escherichia coli. In mfd knockout cells, expression of 75 genes was significantly increased while that of 18 genes was diminished. GO term analysis revealed that the affected genes were disproportionately from certain functional groups. RNA levels in the knockout deviated from wild type beginning at transcription start sites, arguing against premature termination as the cause. RNA-seq analysis in cells overexpressing Mfd revealed dramatic deviation of gene expression in the chromosome terminus region. Taken together, our data support a novel role for Mfd in transcription regulation.
2017-05-01 | GSE81584 | GEO