Mus musculus strain:C57BL/6
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA226025 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:During B cell development the precursor B cell receptor (pre-BCR) checkpoint is thought to increase immunoglobulin k light chain (Igk) locus accessibility to the V(D)J recombinase. Accordingly, pre-B cells lacking the pre-BCR signaling molecules Btk or Slp65 showed reduced germline Vk transcription. To investigate whether pre-BCR signaling modulates Vk accessibility through enhancer-mediated Igk locus topology, we performed chromosome conformation capture and sequencing analyses. These revealed that already in pro-B cells the k enhancers robustly interact with the ~3.2 Mb Vk region and its flanking sequences. Analyses in wild-type, Btk and Slp65 single and double-deficient pre-B cells demonstrated that pre-BCR signaling reduces interactions of both enhancers with Igk locus flanking sequences and increases interactions of the 3â??k enhancer with Vk genes. Remarkably, pre-BCR signaling does not significantly affect interactions between the intronic enhancer and Vk genes, which are already robust in pro-B cells. Both enhancers interact most frequently with highly used Vk genes, which are often marked by transcription factor E2a. We conclude that the k enhancers interact with the Vk region already in pro-B cells and that pre-BCR signaling induces accessibility through a functional redistribution of long-range chromatin interactions within the Vk region, whereby the two enhancers play distinct roles. We performed genome-wide expression profiling of FACS-purified B220+CD19+ pre-B cell fractions from wild-type (WT), Btk and Slp65 single and double deficient VH81x transgenic Rag1-/- mice (n=4 of each genotype). In these experiments non-VH81x transgenic Rag1-/- pro-B cells served as controls (n=3).
2014-03-21 | E-GEOD-53896 | biostudies-arrayexpress
Project description:Pre-BCR Signaling induce IgK Locus Accessibility by functional redistribution of Enhancer-mediated chromatin Interactions
2015-07-31 | E-GEOD-53896 | ExpressionAtlas
Project description:During B cell development the precursor B cell receptor (pre-BCR) checkpoint is thought to increase immunoglobulin k light chain (Igk) locus accessibility to the V(D)J recombinase. Accordingly, pre-B cells lacking the pre-BCR signaling molecules Btk or Slp65 showed reduced germline Vk transcription. To investigate whether pre-BCR signaling modulates Vk accessibility through enhancer-mediated Igk locus topology, we performed chromosome conformation capture and sequencing analyses. These revealed that already in pro-B cells the k enhancers robustly interact with the ~3.2 Mb Vk region and its flanking sequences. Analyses in wild-type, Btk and Slp65 single and double-deficient pre-B cells demonstrated that pre-BCR signaling reduces interactions of both enhancers with Igk locus flanking sequences and increases interactions of the 3’k enhancer with Vk genes. Remarkably, pre-BCR signaling does not significantly affect interactions between the intronic enhancer and Vk genes, which are already robust in pro-B cells. Both enhancers interact most frequently with highly used Vk genes, which are often marked by transcription factor E2a. We conclude that the k enhancers interact with the Vk region already in pro-B cells and that pre-BCR signaling induces accessibility through a functional redistribution of long-range chromatin interactions within the Vk region, whereby the two enhancers play distinct roles.
2014-03-21 | GSE53896 | GEO
Project description:Pre-BCR Signaling induce IgK Locus Accessibility by functional redistribution of Enhancer-mediated chromatin Interactions
| PRJNA236232 | ENA
Project description:Productive rearrangement of the immunoglobulin heavy chain locus triggers a major developmental checkpoint that promotes limited clonal expansion of pre-B cells, culminating in cell cycle arrest and rearrangement of the kappa (κ) or lambda (λ) light-chain loci. B lineage cells lacking the related transcription factors IRF-4 and IRF-8 undergo a developmental arrest at the cycling pre-B cell stage and are blocked for light-chain recombination. Using Irf-4,8-/- pre-B cells we demonstrate that two pathways converge to synergistically drive light-chain rearrangement, a process that is not simply activated by cell cycle exit. One pathway is directly dependent on IRF-4, whose expression is elevated by pre-BCR signaling. IRF-4 targets the κ 3Ⲡand λ enhancers to increase locus accessibility and positions a kappa allele away from pericentromeric heterochromatin. The other pathway is triggered by attenuation of IL-7 signaling and results in activation of the κ intronic enhancer via binding of the transcription factor, E2A. Intriguingly, IRF-4 regulates the expression of CXCR4 and promotes the migration of pre-B cells in response to the chemokine CXCL12. We propose that IRF-4 coordinates the two pathways regulating light-chain recombination by positioning pre-B cells away from IL-7 expressing stromal cells. We used microarrys to identify the changes in gene expression under different levels of the cytokine IL-7 and after rescue of genetic defect. Experiment Overall Design: IRF4,8 null pre-B cells were cultures in the indicated conditions prior to RNA isolation and hybridization to Affymetrix arrays.
2008-06-11 | E-GEOD-10273 | biostudies-arrayexpress
Project description:Productive rearrangement of the immunoglobulin heavy chain locus triggers a major developmental checkpoint that promotes limited clonal expansion of pre-B cells, culminating in cell cycle arrest and rearrangement of the kappa (κ) or lambda (λ) light-chain loci. B lineage cells lacking the related transcription factors IRF-4 and IRF-8 undergo a developmental arrest at the cycling pre-B cell stage and are blocked for light-chain recombination. Using Irf-4,8-/- pre-B cells we demonstrate that two pathways converge to synergistically drive light-chain rearrangement, a process that is not simply activated by cell cycle exit. One pathway is directly dependent on IRF-4, whose expression is elevated by pre-BCR signaling. IRF-4 targets the κ 3′ and λ enhancers to increase locus accessibility and positions a kappa allele away from pericentromeric heterochromatin. The other pathway is triggered by attenuation of IL-7 signaling and results in activation of the κ intronic enhancer via binding of the transcription factor, E2A. Intriguingly, IRF-4 regulates the expression of CXCR4 and promotes the migration of pre-B cells in response to the chemokine CXCL12. We propose that IRF-4 coordinates the two pathways regulating light-chain recombination by positioning pre-B cells away from IL-7 expressing stromal cells. We used microarrys to identify the changes in gene expression under different levels of the cytokine IL-7 and after rescue of genetic defect. Keywords: growth conditions and rescue
2008-01-26 | GSE10273 | GEO
Project description:Lymphomagenesis in the presence of deregulated MYC expression requires suppression of MYC-driven apoptosis, often through downregulation of the pro-apoptotic BCL2L11 gene (Bim). Transcription factors (EBNAs) encoded by the lymphoma-associated Epstein-Barr virus (EBV) activate MYC and silence BCL2L11. We show that EBNA2 upregulates MYC by reconfiguring the 3 Mb MYC locus to increase upstream and decrease downstream enhancer-promoter interactions. EBNA2 recruits the SWI/SNF ATPase BRG1 to drive MYC enhancer-promoter interactions. MYC-Immunoglobulin translocation breakpoints in EBV-positive endemic Burkitt lymphoma localise to EBNA2-activated upstream MYC regions. This implicates EBV in the genesis and localisation of breakpoints, since active enhancers are targeted by activation-induced cytidine deaminase. We identify a novel haematopoietic BCL2L11 enhancer hub that is inactivated by EBNA3A and EBNA3C through recruitment of the H3K27 methyltransferase EZH2. Reversal of enhancer inactivation using an EZH2 inhibitor upregulates BCL2L11 and induces apoptosis. EBV therefore drives lymphomagenesis by hijacking long-range enhancer hubs and specific cellular co-factors. A study of MYC enhancer-promoter interactions using 4C on induction of MYC by the Epstein-Barr virus transcription factor EBNA2 in a lymphoblastoid cell line.
2016-08-04 | E-GEOD-82149 | biostudies-arrayexpress
Project description:Lymphomagenesis in the presence of deregulated MYC expression requires suppression of MYC-driven apoptosis, often through downregulation of the pro-apoptotic BCL2L11 gene (Bim). Transcription factors (EBNAs) encoded by the lymphoma-associated Epstein-Barr virus (EBV) activate MYC and silence BCL2L11. We show that EBNA2 upregulates MYC by reconfiguring the 3 Mb MYC locus to increase upstream and decrease downstream enhancer-promoter interactions. EBNA2 recruits the SWI/SNF ATPase BRG1 to drive MYC enhancer-promoter interactions. MYC-Immunoglobulin translocation breakpoints in EBV-positive endemic Burkitt lymphoma localise to EBNA2-activated upstream MYC regions. This implicates EBV in the genesis and localisation of breakpoints, since active enhancers are targeted by activation-induced cytidine deaminase. We identify a novel haematopoietic BCL2L11 enhancer hub that is inactivated by EBNA3A and EBNA3C through recruitment of the H3K27 methyltransferase EZH2. Reversal of enhancer inactivation using an EZH2 inhibitor upregulates BCL2L11 and induces apoptosis. EBV therefore drives lymphomagenesis by hijacking long-range enhancer hubs and specific cellular co-factors. A study of MYC enhancer-promoter interactions using 4C on induction of MYC by Epstein-Barr virus infection of CD19+ primary B cells. B cells physiologically activated by treatment with CD40 ligand and IL-4 were studied as a control.
2016-08-04 | E-GEOD-82148 | biostudies-arrayexpress
Project description:Immunoglobulin class switch recombination (CSR) is initiated by the transcription-coupled recruitment of activation induced cytidine deaminase (AID) to immunoglobulin switch (S) regions. During CSR, the IgH locus undergoes dynamic three-dimensional structural changes in which promoters, enhancers and S regions are brought to close proximity. Nevertheless, little is known about the underlying mechanisms. Here we conditionally inactivated in B cells the Med1 subunit of mediator, a complex implicated in transcription initiation and long-range enhancer/promoter loop formation. We find that Med1-deficiency results in defective CSR, reduced acceptor switch region transcription and that this correlates with reduced long-range interactions between the acceptor switch regions and the Em enhancer, as determined by 4C-Seq. Our results implicate the mediator complex in the mechanism of CSR and are consistent with a model in which Med1 facilitates the transcriptional activation of switch regions and their long-range contacts with the IgH locus enhancers during CSR. 4C-seq data in resting and activated WT and Med1 mutant B cells. 4C bait was designed in the Eu enhancer of the Igh locus on chromosome 12. Primer sequences: 5â TCTGTCCTAAAGGCTCTGAGA 3â and 5â GAACACAGAAGTATGTGTATGGA 3â.
2016-02-17 | E-GEOD-62969 | biostudies-arrayexpress
Project description:We identified an enhancer element near IGF2 locus that is possibly involved with dopamine function and schizophrenia. A knockout mouse was generated for the enhancer element in the IGF2 locus. We then characterized the striatal synaptosomes ( i.e. biological fraction representing pre- post synaptic nerve terminal)by mass spectometry from WT and Igf2 enhancer KO mice.
2019-05-31 | PXD012786 | Pride