Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Klebsiella pneumoniae strain:KCTC 2242

ABSTRACT: Klebsiella pneumoniae budA mutant Transcriptome

PROVIDER: PRJNA274872 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR1821722_1.fastq.gz	Fastqsanger.gz
	SRR1821722_2.fastq.gz	Fastqsanger.gz

Items per page:

1 - 2 of 2

Similar Datasets

Klebsiella pneumoniae KCTC 2242

Project description:Klebsiella pneumoniae budB mutant Transcriptome

| PRJNA274873 | ENA

Klebsiella pneumoniae KCTC 2242

Project description:Klebsiella pneumoniae budC mutant Transcriptome

| PRJNA274875 | ENA

Gene expression in Klebsiella pneumoniae

Project description:Elucidating the RamA Regulon in Klebsiella pneumoniae and the transcriptome profiles of multidrug resistant Klebsiella pneumoniae

2017-12-25 | GSE24688 | GEO

Klebsiella pneumoniae KCTC 2242

Project description:Klebsiella pneumoniae SGSB100 Transcriptome or Gene expression

| PRJNA274869 | ENA

Klebsiella pneumoniae KCTC 2242

Project description:Klebsiella pneumoniae KCTC 2242 Transcriptome or Gene expression

| PRJNA274876 | ENA

Complete genome sequence of the 2,3-butanediol-producing Klebsiella pneumoniae strain KCTC 2242.

Project description:Here we report the full genome sequence of Klebsiella pneumoniae KCTC 2242,consisting of a 5.26-Mb chromosome (57.6% GC%; 5,035 genes [4,923 encoding known proteins, 112 RNA genes]) and a 202-kb plasmid (50.2% GC%; 229 genes [229 encoding known proteins]).

| S-EPMC3347200 | biostudies-literature

Klebsiella pneumoniae KCTC 2242

Project description:Klebsiella pneumoniae KCTC 2242 Genome sequencing

| PRJNA67293 | ENA

Listeria Monocytogenes La111 and Klebsiella Pneumoniae KCTC 2242: Shine-Dalgarno Sequences.

Project description:Listeria monocytogenes can cause serious infection and recently, relapse of listeriosis has been reported in leukemia and colorectal cancer, and the patients with Klebsiella pneumoniae are at increased risk of colorectal cancer. Translation initiation codon recognition is basically mediated by Shine-Dalgarno (SD) and the anti-SD sequences at the small ribosomal RNA (ssu rRNA). In this research, Shine-Dalgarno sequences prediction in Listeria monocytogenes La111 and Klebsiella pneumoniae KCTC 2242 was investigated. The whole genomic sequence of Listeria monocytogenes La111 and Klebsiella pneumoniae KCTC 2242 were retrieved from http://www.ncbi.nlm.nih.gov/ (Listeria monocytogenes La111 NCBI Reference sequence: NC_020557; Klebsiella pneumoniae KCTC 2242 NCBI Reference sequence: CP002910) in order to be analyzed with DAMBE software and BLAST. The results showed that the consensus sequence for Klebsiella pneumoniae KCTC 2242 was CCCCCCCUCCCCCUCCCCCUCCUCCUCCUUUUUAAAAAAGGGGAAAAACC and for Listeria monocytogenes La111 was CCCCCCCUCCCCCUUUCCCUCCUAUUCUUAUAAAAGGGGG-GGGGUUCAC. The PSD was higher in Listeria monocytogenes La111 compared to Klebsiella pneumoniae KCTC 2242 (0.9090> 0.8618). The results showed that Nm in Listeria monocytogenes La111 was higher than Klebsiella pneumoniae KCTC 2242 (4.5846> 4.4862). Accurate characterization of SD sequences may increase our knowledge on how an organism's transcriptome is related to its cellular proteome.

| S-EPMC3927391 | biostudies-literature

Expression analysis of Klebsiella pneumoniae MGH 78578 and capsule deletion mutant

Project description:To investigate the whole-genome gene expression difference between the wild-type and capsule deletion mutant in Klebsiella pneumoniae MGH 78578. The mutants analyzed in this study are further described in Huang T.W., Stapleton J.C., Chang H.Y., Tsai S.F., Palsson B.O., Charusanti P. Capsule removal via lambda-Red knockout system perturbs biofilm formation and fimbriae extression in Klesiella pneumoniae MGH 78578 (manuscript submission) A six chip study using total RNA recovered from three separate wild-type cultures and three separate cultures of a capsule deltion mutant of Klebsiella pneumoniae MGH 78578. The capsule gene cluster (KPN_02493 to KPN_02515) was entirely removed in the capsule deletion mutant. Each chip measures the expression level of 5,305 genes from Klebsiella pneumoniae MGH 78578 and the associated five plasmids (pKPN3, pKPN4, pKPN5, pKPN6 and pKPN7) with 50-mer oligo tiling array with 30-mer spacer.

2013-12-31 | E-GEOD-40011 | biostudies-arrayexpress

Bdellovibrio RNA seqence (Klebsiella pneumoniae)

Project description:The evaluating the response of Bdellovibrio bacteriovorus HD100 with specific prey (Klebsiella pneumoniae)

2021-04-09 | GSE112863 | GEO