Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Klebsiella pneumoniae KCTC 2242

ABSTRACT: Klebsiella pneumoniae KCTC 2242 Transcriptome or Gene expression

PROVIDER: PRJNA274876 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR1821719_1.fastq.gz	Fastqsanger.gz
	SRR1821719_2.fastq.gz	Fastqsanger.gz

Items per page:

1 - 2 of 2

Similar Datasets

Klebsiella pneumoniae KCTC 2242

Project description:Klebsiella pneumoniae KCTC 2242 Genome sequencing

| PRJNA67293 | ENA

Expression analysis of strains Streptococcus pneumoniae KCTC 5080T, Streptococcus mitis KCTC 3556T, Streptococcus oralis KCTC 13048T, and Streptococcus pseudopneumoniae CCUG 49455T

Project description:Investigation of whole genome gene expression level changes in S. pneumoniae KCTC 5080T, S. mitis KCTC 3556T, S. oralis KCTC 13048T, and S. pseudopneumoniae CCUG 49455T. This proves that transcriptional profiling can facilitate in elucidating the genetic distance between closely related strains. A one chip study using total RNA recovered from S. pseudopneumoniae CCUG 49455T with three strain. For the the transcriptome of S. pseudopneumoniae CCUG 49455T was analyzed using the S. pneumoniae R6 microarray platform and compared with those of S. pneumoniae KCTC 5080T, S. mitis KCTC 3556T, and S. oralis KCTC 13048T strains.

2012-04-26 | E-GEOD-37539 | biostudies-arrayexpress

Klebsiella pneumoniae KCTC 2242

Project description:Klebsiella pneumoniae SGSB100 Transcriptome or Gene expression

| PRJNA274869 | ENA

Expression analysis of strains Streptococcus pneumoniae KCTC 5080T, Streptococcus mitis KCTC 3556T, Streptococcus oralis KCTC 13048T, and Streptococcus pseudopneumoniae CCUG 49455T

2012-04-27 | GSE37539 | GEO

Gene expression in Klebsiella pneumoniae

Project description:Elucidating the RamA Regulon in Klebsiella pneumoniae and the transcriptome profiles of multidrug resistant Klebsiella pneumoniae

2017-12-25 | GSE24688 | GEO

Klebsiella pneumoniae KCTC 2242

Project description:Klebsiella pneumoniae budB mutant Transcriptome

| PRJNA274873 | ENA

Klebsiella pneumoniae KCTC 2242

Project description:Klebsiella pneumoniae budC mutant Transcriptome

| PRJNA274875 | ENA

Klebsiella pneumoniae strain:KCTC 2242

Project description:Klebsiella pneumoniae budA mutant Transcriptome

| PRJNA274872 | ENA

Listeria Monocytogenes La111 and Klebsiella Pneumoniae KCTC 2242: Shine-Dalgarno Sequences.

Project description:Listeria monocytogenes can cause serious infection and recently, relapse of listeriosis has been reported in leukemia and colorectal cancer, and the patients with Klebsiella pneumoniae are at increased risk of colorectal cancer. Translation initiation codon recognition is basically mediated by Shine-Dalgarno (SD) and the anti-SD sequences at the small ribosomal RNA (ssu rRNA). In this research, Shine-Dalgarno sequences prediction in Listeria monocytogenes La111 and Klebsiella pneumoniae KCTC 2242 was investigated. The whole genomic sequence of Listeria monocytogenes La111 and Klebsiella pneumoniae KCTC 2242 were retrieved from http://www.ncbi.nlm.nih.gov/ (Listeria monocytogenes La111 NCBI Reference sequence: NC_020557; Klebsiella pneumoniae KCTC 2242 NCBI Reference sequence: CP002910) in order to be analyzed with DAMBE software and BLAST. The results showed that the consensus sequence for Klebsiella pneumoniae KCTC 2242 was CCCCCCCUCCCCCUCCCCCUCCUCCUCCUUUUUAAAAAAGGGGAAAAACC and for Listeria monocytogenes La111 was CCCCCCCUCCCCCUUUCCCUCCUAUUCUUAUAAAAGGGGG-GGGGUUCAC. The PSD was higher in Listeria monocytogenes La111 compared to Klebsiella pneumoniae KCTC 2242 (0.9090> 0.8618). The results showed that Nm in Listeria monocytogenes La111 was higher than Klebsiella pneumoniae KCTC 2242 (4.5846> 4.4862). Accurate characterization of SD sequences may increase our knowledge on how an organism's transcriptome is related to its cellular proteome.

| S-EPMC3927391 | biostudies-literature

Bdellovibrio RNA seqence (Klebsiella pneumoniae)

Project description:The evaluating the response of Bdellovibrio bacteriovorus HD100 with specific prey (Klebsiella pneumoniae)

2021-04-09 | GSE112863 | GEO