Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Expression profiling and occupancy after knockdown or over-expression of HFN1A or HNF4G in prostate cancer cells

ABSTRACT: Expression profiling and occupancy after knockdown or over-expression of HFN1A or HNF4G in prostate cancer cells

PROVIDER: PRJNA338783 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR4025870.fastq.gz	Fastqsanger.gz
	SRR4025880.fastq.gz	Fastqsanger.gz
	SRR4025890.fastq.gz	Fastqsanger.gz
	SRR4025900.fastq.gz	Fastqsanger.gz
	SRR4025930.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 45

Similar Datasets

HNF4G, AR, FOXA1, H3K4me1, H3K27acetyl binding sites upon knockdown and overexpression of HNF4G in 22Rv1 and LNCaP prostate cancer cells respectively

Project description:HNF4G is a gastrointestinal tissue enriched master transcriptional regulator seen overexpressed in a subset of prostate cancer. Here we have mapped binding sites of HNF4G, AR, Foxa1, H3K4me1, H3K27acetyl upon knockdown and overexpression of HNF4G in in 22Rv1 and LNCaP cells respectively

2017-11-01 | GSE85558 | GEO

Gene expression changes upon knockdown or over-expression of the ETS gene ETV4 in prostate cancer cell lines

Project description:Chromosomal abnormalities that give rise to elevated expression levels of the ETS genes ETV1, ETV4, ETV5, or ERG are prevalent in prostate cancer, but the function of these transcription factors in carcinogenesis is not clear. Previous work implicates ERG, ETV1, and ETV5 as regulators of invasive growth but not transformation in cell lines. Here we show that the PC3 prostate cancer cell line provides a model system to study the over-expression of ETV4. Anchorage independent growth assays and microarray analysis indicate that high ETV4 expression is critical for the transformation phenotype of PC3 cells. However, genes up-regulated upon ETV4 over-expression were very similar to genes up-regulated by ETV1 over-expression in the RWPE-1 normal prostate cell line. Together these data indicate that the ETV4 dependent transformation phenotype observed in PC3 cells is due to the genetic background of the cell line, rather than a distinct characteristic of ETV4. Furthermore, these findings suggest that the function of ETS genes in prostate cancer may differ based on other genetic alterations in a tumor.

2011-03-25 | GSE21209 | GEO

Gene expression profile of doxycycline inducible shHNF4G hairpins in 22RV1 prostate cancer cells

Project description:To determine genes regulated by HNF4G, we performed doxycycline induced shRNA mediated knockdown of HNF4G using two lentiviral constructs as well as a scrambled shRNA in duplicate. Two pLKO.1 constructs against HNF4G (HNF4Gsh1: TRCN0000019243, targeting CACCAGCATCTCTCCAAACAA in coding DNA sequence (CDS); and HNF4Gsh2: TRCN0000420190, targeting GATGAGCTGGTTAGACCATTTC in CDS) were purchased from Sigma Aldrich MISSION® shRNA Plasmid DNA and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after doxycycline treatment and gene expression profiling was performed.

2017-11-01 | GSE85242 | GEO

Gene expression profiling of prostate cells with CHD1 knockdown

Project description:Gene expression profiling of prostate tumor cells comparing cells that have CHD1 knockdown by shRNA (RWPE-1, OPCN2) or siRNA (LNCaP) with cells treated with non-targeted control. Prostate cell lines had CHD1 knockdown via shRNA or siRNA were hybridized against cells that were targeted with non-targeting control. OPCN2 and RWPE-1 RNA were dye-swapped in replicate experiments.

2011-12-19 | E-GEOD-33531 | biostudies-arrayexpress

Gene expression changes upon knockdown or over-expression of the ETS gene ETV4 in prostate cancer cell lines

2011-03-24 | E-GEOD-21209 | biostudies-arrayexpress

Gene expression profiling and H3K9ac occupancy in Nedd4 knockdown Hep3B cells

Project description:Gene expression profiling and H3K9ac occupancy in Nedd4 knockdown Hep3B cells

| PRJNA276569 | ENA

TRIM24 occupancy and TRIM24-dependent gene expression in prostate cancer cells

Project description:TRIM24 occupancy and TRIM24-dependent gene expression in prostate cancer cells

| PRJNA285228 | ENA

PRMT5 knockdown changes gene expression in prostate cancer cells

Project description:PRMT5 knockdown changes gene expression in prostate cancer cells

| PRJNA482621 | ENA