Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: 16s amplicon sequencing V3-V4 region from Pisaster ochraceus samples with and without Sea Star Wasting Disease

PROVIDER: PRJNA407315 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR6060390_1.fastq.gz	Fastqsanger.gz
	SRR6060390_2.fastq.gz	Fastqsanger.gz
	SRR6060400_1.fastq.gz	Fastqsanger.gz
	SRR6060400_2.fastq.gz	Fastqsanger.gz
	SRR6060410_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 354

Similar Datasets

An Initial Comparative Genomic Autopsy of Wasting Disease in Sea Stars

Project description:Beginning in 2013, sea stars throughout the Eastern North Pacific were decimated by wasting disease, also known as ‘asteroid idiopathic wasting syndrome’ (AIWS) due to its elusive etiology. The geographic extent and taxonomic scale of AIWS meant events leading up to the outbreak were heterogeneous, multifaceted, and oftentimes unobserved; progression from morbidity to death was rapid, leaving few tell-tale symptoms. Here we take a forensic genomic approach to discover candidate genes that may help explain sea star wasting syndrome. We report the first genome and annotation for P. ochraceus, along with differential gene expression (DGE) analyses in four size classes, three tissue types, and in symptomatic and asymptomatic individuals. We integrate nucleotide polymorphisms associated with survivors of the wasting disease outbreak, DGE associated with temperature treatments in P. ochraceus, and DGE associated with wasting in another asteroid Pycnopodia helianthoides. In P. ochraceus, we find DGE across all tissues, among size classes, and between asymptomatic and symptomatic individuals; the strongest wasting-associated DGE signal is in pyloric caecum. We also find previously identified outlier loci co-occur with differentially expressed genes. In cross-species comparisons of symptomatic and asymptomatic individuals, consistent responses distinguish genes associated with invertebrate innate immunity and chemical defense, consistent with context-dependent stress responses, defensive apoptosis, and tissue degradation. Our analyses thus highlight genomic constituents that may link suspected environmental drivers (elevated temperature) with intrinsic differences among individuals (age/size, alleles associated with susceptibility) that elicit organismal responses (e.g. coelomocyte proliferation) and manifest as sea star wasting mass mortality.

2020-02-19 | GSE144422 | GEO

Pisaster Microbiome

Project description:The sea star, Pisaster ochraceus, has unique and dominant bacteria.

| PRJEB35121 | ENA

Project description:Microbial Ecology of Wasting Disease in Pisaster ochraceus

| PRJNA637333 | ENA

Pisaster ochraceus

Project description:Pisaster ochraceus overview

| PRJNA299703 | ENA

Project description:Wasting Disease in Forbe's Sea star

| PRJNA376453 | ENA

Project description:Differential gene expression patterns among wasting Pisaster ochraceus individuals following organic matter enrichment

| PRJNA1116313 | ENA

food fermentation metagenome

Project description:16S V3-V4 amplicon sequencing

| PRJDB9082 | ENA

Project description:Pisaster ochraceus Raw sequence reads

| PRJNA445895 | ENA

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

Project description:16S rRNA gene V3-V4 region sequencing

| PRJNA895234 | ENA