Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: Shotgun metagenome library

PROVIDER: PRJNA454892 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR7125600_1.fastq.gz	Fastqsanger.gz
	SRR7125600_2.fastq.gz	Fastqsanger.gz
	SRR7125610_1.fastq.gz	Fastqsanger.gz
	SRR7125610_2.fastq.gz	Fastqsanger.gz
	SRR7125620_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 166

Similar Datasets

Interactions of CAF1-NOT complex components from Trypanosoma brucei

Project description:Our trypanosome yeast two-hybrid prey library was made by random shotgun genomic cloning. NOT2, NOT10, NOT11 and CAF40 were used as baits to screen the library by mating. Diploid progeny were subjected to selection, resulting in between 100 and 800 surviving colonies, from which inserts were amplified and subjected to high-throughput sequencing. This is a Multiplex Library identified using the following primers: >CZ5468-Not1 CTCTACCCATCGAGCTCGAGCTACGTCAACG >CZ5472-ZC3H38 TCGGGACATCGAGCTCGAGCTACGTCAACG >CZ5473-Tb927_7_2780 GAATGAATCGAGCTCGAGCTACGTCAACG >CZ5474-Not11 TGACATCCATCGAGCTCGAGCTACGTCAACG. Yeast 2-hybrid Interactions for NOT10 (Tb927.10.8720), NOT11 (Tb927.8.1960), XAC1 (Tb927.7.2780) and ZC3H38 (Tb927.10.12800)

2022-01-14 | E-MTAB-4946 | biostudies-arrayexpress

Unlock the mystery of the hard-to-sequence phage genome: discovering a novel mechanism of bacterial immunity

Project description:Whole-genome sequencing is an important way to understand the genetic information, gene function, biological characteristics, and living mechanisms of organisms. There is no difficulty to have mega-level genomes sequenced at present. However, we encountered a hard-to-sequence genome of Pseudomonas aeruginosa phage PaP1. The shotgun sequencing method failed to dissect this genome. After insisting for 10 years and going over 3 generations of sequencing techniques, we successfully dissected the PaP1 genome with 91,715 bp in length. Single-molecule sequencing revealed that this genome contains lots of modified bases, including 51 N6-methyladenines (m6A) and 152 N4-methylcytosines (m4C). At the same time, further investigations revealed a novel immune mechanism of bacteria, by which the host bacteria can recognize and repel the modified bases containing inserts in large scale, and this led to the failure of the shotgun method in PaP1 genome sequencing. Strategy of resolving this problem is use of non-library dependent sequencing techniques or use of the nfi- mutant of E. coli DH5M-NM-1 as the host bacteria to construct the shotgun library. In conclusion, we unlock the mystery of phage PaP1 genome hard to be sequenced, and discover a new mechanism of bacterial immunity in present study. Methylation profiling of Pseudomonas aeruginosa phage PaP1 using kinetic data generated by single-molecule, real-time (SMRT) sequencing on the PacBio RS.

2013-08-22 | E-GEOD-50100 | biostudies-arrayexpress

Podocnemis lewyana

Project description:Podocnemis lewyana genome shotgun library

| PRJNA273652 | ENA

Unlock the mystery of the hard-to-sequence phage genome: discovering a novel mechanism of bacterial immunity

Project description:Whole-genome sequencing is an important way to understand the genetic information, gene function, biological characteristics, and living mechanisms of organisms. There is no difficulty to have mega-level genomes sequenced at present. However, we encountered a hard-to-sequence genome of Pseudomonas aeruginosa phage PaP1. The shotgun sequencing method failed to dissect this genome. After insisting for 10 years and going over 3 generations of sequencing techniques, we successfully dissected the PaP1 genome with 91,715 bp in length. Single-molecule sequencing revealed that this genome contains lots of modified bases, including 51 N6-methyladenines (m6A) and 152 N4-methylcytosines (m4C). At the same time, further investigations revealed a novel immune mechanism of bacteria, by which the host bacteria can recognize and repel the modified bases containing inserts in large scale, and this led to the failure of the shotgun method in PaP1 genome sequencing. Strategy of resolving this problem is use of non-library dependent sequencing techniques or use of the nfi- mutant of E. coli DH5α as the host bacteria to construct the shotgun library. In conclusion, we unlock the mystery of phage PaP1 genome hard to be sequenced, and discover a new mechanism of bacterial immunity in present study.

2013-08-22 | GSE50100 | GEO