Macrophage Syk-PI3Kγ-HIF axis controls tumor immune suppression
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA473813 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR7235750.fastq.gz | Fastqsanger.gz | |||
| SRR7235760.fastq.gz | Fastqsanger.gz | |||
| SRR7235770.fastq.gz | Fastqsanger.gz | |||
| SRR7235741.fastq.gz | Fastqsanger.gz | |||
| SRR7235751.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 30 |
Similar Datasets
Project description:Macrophages (MΘs) play a critical role in tumor growth, immunosuppression and inhibition of adaptive immune responses in cancer. Hence, targeting signaling pathways in MΘs that promote tumor immunosuppression will provide therapeutic benefit. PI3Kγ has been recently established by our group and others as a novel immuno-oncology target. Herein, we report that macrophage Syk drives polarization of immunosuppressive macrophages which establish an immunosuppressive tumor microenvironment in in vivo syngeneic tumor models. Genetic or pharmacological blockade of Syk in MΘs promotes a pro-inflammatory MΘ phenotype, restores CD8+ T cell activity, destabilizes HIF under hypoxia, and stimulates antitumor immune response. Moreover, we have developed in silico the “first in class” dual Syk/PI3K inhibitor, SRX3207, for the combinatorial inhibition of Syk and PI3K in one small molecule to activate anti-tumor immunity in vivo. This chemotype shows great efficacy in various tumor models and represents a new therapeutic approach to treat devastating cancers. Significance: Our data indicate a central role of Syk in macrophage transcriptional programming leading to inhibition of adaptive immune responses. Furthermore, SRX3207 blocks macrophage expression of immunosuppressive factors and activates anti-tumor immune responses, validating the concept of combined Syk and PI3K inhibition as an effective approach to treat macrophage driven cancers.
2020-09-01 | GSE115109 | GEO
Project description:Macrophages, play an essential role in promoting tumor growth by affecting angiogenesis, immune suppression, invasion and metastasis. The signal transduction events within macrophages which encode the complex cascade of events required for tumor growth and polarization of macrophages are poorly understood. We have discovered an ECM dependent signaling pathway in macrophages that regulates M2 macrophage differentiation, tumor growth, invasion and metastasis. We provide direct evidence that a macrophage autonomous, M-NM-14M-NM-21 integrin dependent Syk-Rac2 signaling axis acts in concert with the p110 isoform (PTEN-PI-3 kinase pathway) to control metastasis. Bone marrow derived macrophages from five wild type and five Rac2 -/- mutant C57BL mice.
2012-10-02 | E-GEOD-41236 | biostudies-arrayexpress
Project description:Macrophages, play an essential role in promoting tumor growth by affecting angiogenesis, immune suppression, invasion and metastasis. The signal transduction events within macrophages which encode the complex cascade of events required for tumor growth and polarization of macrophages are poorly understood. We have discovered an ECM dependent signaling pathway in macrophages that regulates M2 macrophage differentiation, tumor growth, invasion and metastasis. We provide direct evidence that a macrophage autonomous, α4β1 integrin dependent Syk-Rac2 signaling axis acts in concert with the p110 isoform (PTEN-PI-3 kinase pathway) to control metastasis. SmoA1 Tg MB tumor cells were sorted into CD15+ and CD15- populations. RNA from these samples were hybridized to Affymetrix Mouse Genome 1.0 ST array.
2012-11-15 | E-GEOD-41717 | biostudies-arrayexpress
Project description:Macrophages, play an essential role in promoting tumor growth by affecting angiogenesis, immune suppression, invasion and metastasis. The signal transduction events within macrophages which encode the complex cascade of events required for tumor growth and polarization of macrophages are poorly understood. We have discovered an ECM dependent signaling pathway in macrophages that regulates M2 macrophage differentiation, tumor growth, invasion and metastasis. We provide direct evidence that a macrophage autonomous, α4β1 integrin dependent Syk-Rac2 signaling axis acts in concert with the p110 isoform (PTEN-PI-3 kinase pathway) to control metastasis.
2012-11-15 | GSE41717 | GEO
Project description:Macrophages, play an essential role in promoting tumor growth by affecting angiogenesis, immune suppression, invasion and metastasis. The signal transduction events within macrophages which encode the complex cascade of events required for tumor growth and polarization of macrophages are poorly understood. We have discovered an ECM dependent signaling pathway in macrophages that regulates M2 macrophage differentiation, tumor growth, invasion and metastasis. We provide direct evidence that a macrophage autonomous, α4β1 integrin dependent Syk-Rac2 signaling axis acts in concert with the p110 isoform (PTEN-PI-3 kinase pathway) to control metastasis.
2012-10-02 | GSE41236 | GEO
Project description:An mass spectrometry approach in RAW264.7 macrophages on mouse SYK following 16 h treatment with 250 mM OI in RAW264.7 cells.
2023-02-19 | PXD040253 |
Project description:We recently identified the nonreceptor tyrosine kinase syk as a tumor suppressor in pancreatic ductal adenocarcinoma cells. Reintroduction of syk into Panc1 cells promoted a more differentiated phenotype and retarded invasion and tumorigenic growth. Gene array analysis identified over 2,000 transcripts differentially expressed at FDR<0.01. Among these were members of the MMP2 axis, which were subsequently shown to regulate Panc1 invasion. Experiment Overall Design: Affymetrix global gene arrays were used to analyse differences in gene expression patterns in Panc1 cells stably reexpressing syk, or vector-only mock controls. RNA was harvested from cells grown under identical conditions in standard culture.
2009-09-18 | E-GEOD-18000 | biostudies-arrayexpress
Project description:Cutaneous leishmaniasis (CL) is responsible for a significant burden of the global incidence of neglected tropical diseases, with 12 million people currently infected with Leishmania parasites. CL contains a spectrum of disease manifestations, ranging from self-healing skin lesions to permanent disfigurations. Currently there is no vaccine available, and many patients are refractory to treatment, emphasizing the need for new therapeutic targets. Previous work has demonstrated the necessity of macrophage HIF-alpha-mediated lymphangiogenesis to achieve efficient wound resolution during murine L. major infection. Here we investigate the role of macrophage HIF-alpha signaling separate from lymphangiogenesis, employing RNA-Seq transcriptome analysis on macrophages with intact or compromised HIF-alpha signaling, LysMCreARNTf/+ or LysMCreARNTf/f respectively, during L. major infection and under pro-inflammatory stimulus. We report that L. major infection alone is enough to induce HIF-alpha dependent transcriptomic changes while infection with L. major and pro-inflammatory stimuli administration instigates transcriptomic changes both dependent and independent of HIF-alpha signaling. Additionally, by coupling transcriptomic analysis with several pathway analyses, we found during L. major infection and in a pro-inflammatory environment, HIF-alpha suppresses pathways involved in protein translation such as the ribosome pathway and EIF2 signaling. Together this work supports infection with L. major induces a HIF-alpha transcriptomic program, but only in a pro-inflammatory environment does HIF-alpha suppress protein translation.
2024-11-01 | GSE273822 | GEO
Project description:Cooperative dependencies between mutant oncoproteins and wild-type proteins are critical in cancer pathogenesis and therapy resistance. Although spleen tyrosine kinase (SYK) has been implicated in hematologic malignancies, it is rarely mutated. We used kinase activity profiling to identify collaborators of SYK in acute myeloid leukemia (AML) and determined that FMS-like tyrosine kinase 3 (FLT3) is transactivated by SYK via direct binding. Highly activated SYK is predominantly found in FLT3-ITD positive AML and cooperates with FLT3-ITD to activate MYC transcriptional programs. FLT3-ITD AML cells are more vulnerable to SYK suppression than FLT3 wild-type counterparts. In a FLT3-ITD in vivo model, SYK is indispensable for myeloproliferative disease (MPD) development, and SYK overexpression promotes overt transformation to AML and resistance to FLT3-ITD-targeted therapy. HL-60, MOLM-14, and U937 cell lines were transduced in triplicate with a control luciferase-directed shRNA (target sequence CCTAAGGTTAAGTCGCCCTCG), and in duplicate with two SYK-directed shRNAs: shSYK_1 (clone ID TRCN0000197257, target sequence GCAGCAGAACAGACATGTCAA) and shSYK_2 (clone ID TRCN0000003163 , target sequence GCAGGCCATCATCAGTCAGAA), and were then selected with 1 µg/ml puromycin 48 hours post-infection. At day 5 post-infection, RNA was extracted and profiled using HT HG-U133A arrays (Affymetrix) at the Broad Institute (Cambridge, MA, USA). The computational analysis of the gene expression data was performed through the Genome Space bioinformatics platform (http://www.genomespace.org).
2014-01-15 | E-GEOD-54065 | biostudies-arrayexpress
Project description:Cooperative dependencies between mutant oncoproteins and wild-type proteins are critical in cancer pathogenesis and therapy resistance. Although spleen tyrosine kinase (SYK) has been implicated in hematologic malignancies, it is rarely mutated. We used kinase activity profiling to identify collaborators of SYK in acute myeloid leukemia (AML) and determined that FMS-like tyrosine kinase 3 (FLT3) is transactivated by SYK via direct binding. Highly activated SYK is predominantly found in FLT3-ITD positive AML and cooperates with FLT3-ITD to activate MYC transcriptional programs. FLT3-ITD AML cells are more vulnerable to SYK suppression than FLT3 wild-type counterparts. In a FLT3-ITD in vivo model, SYK is indispensable for myeloproliferative disease (MPD) development, and SYK overexpression promotes overt transformation to AML and resistance to FLT3-ITD-targeted therapy.
2014-01-15 | GSE54065 | GEO