Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Cave metagenome

ABSTRACT: 16S rRNA gene V4 region of samples from karst caves in southwest China Raw sequence reads

PROVIDER: PRJNA497480 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR8088380.fastq.gz	Fastqsanger.gz
	SRR8088390.fastq.gz	Fastqsanger.gz
	SRR8088400.fastq.gz	Fastqsanger.gz
	SRR8088410.fastq.gz	Fastqsanger.gz
	SRR8088420.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 134

Similar Datasets

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

Project description:Soil 16S rRNA sequencing of soybean rhizosphere in a karst region in Southwest China

| PRJNA627262 | ENA

Project description:16S rRNA amplions from karst caves

| PRJNA1155256 | ENA

a7bcbc51-217a-491f-808b-617da8eeca65 - samples

Project description:Fecal samples Illumina MiSeq 16S rRNA sequencing, V4 hypervariable region

| EGAD00001004106 | EGA

Targeting the treponemal microbiome of digital dermatitis infections by deep coverage pyrosequencing

Project description:We examined 36 biopsies taken from digital dermatitis lesions of Holstein cows. The target was the V3 -V4 variable region of 16S rRNA using Treponema specific primers. We identified 20 different taxa of Treponema using this approach.

2013-06-25 | GSE42426 | GEO

Gut microbiota analysis of colitic SD rats

Project description:Fecal samples collected on day 5 from randomly selected colitic SD rats were analyzed for gut microbiota by sequencing the V4 region of the 16S rRNA gene. The orally administered Dex-P-laden NPA2 coacervate (Dex-P/NPA2) significantly restores the diversity of gut microbiota compared with colitic SD rats in the Dex-P/PBS group and the untreated colitic rats (Control).

2021-11-06 | GSE167138 | GEO

582f7f57-cdc9-4840-91d7-9e2e97e1f33a - samples

Project description:16S rRNA gene V3-V4 region sequenced from 15 saliva samples of farmers from Palanan (Philippines)

| EGAD00001007727 | EGA

ena-DATASET-KULVIB-19-10-2018-12:35:21:241-524 - samples

Project description:16S rRNA gene sequencing with Illumina MiSeq (V4 hypervariable region)

| EGAD00001004406 | EGA

e185bdec-e87c-474e-9e6c-590de1e4be24 - samples

Project description:16S rRNA gene V3-V4 region sequenced from 148 saliva samples of Agta hunter-gatherers from Philippines.

| EGAD00001007726 | EGA

c2cbd7b5-5afc-4ca0-bdfe-d6f6922ea2ec - samples

Project description:16S rRNA gene V3-V4 region sequenced from 21 saliva samples of BaYaka hunter-gatherer from Congo.