Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Gene expression data from bladder cancer patient-derived cells treated with shRNA targeting ALDH1A1

ABSTRACT: Gene expression data from bladder cancer patient-derived cells treated with shRNA targeting ALDH1A1

PROVIDER: PRJNA508623 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Similar Datasets

Gene expression data from bladder cancer patient-derived cells treated with shRNA targeting ALDH1A1

Project description:To examine the role of ALDH1A1 in bladder cancer ｐａｔｉｅｎｔ-derived cells (PDCs), BC-1 and -2 cells were treated with shRNA targeting ALDH1A1 (shALDH1A1) or control shRNA (shControl). ALDH1A1 knockdown study showed that TUBB3 is one of the downregulated genes in PDCs.

2021-12-06 | GSE123396 | GEO

ALDH1A1 Promotes Immune Escape of Tumor Cells through ZBTB7B-Glycolysis Pathway

Project description:Background The primary impediment to the success of immunotherapy lies in the immune evasion orchestrated by tumors, contributing to the suboptimal overall response rates observed. Despite this recognition, the intricacies of the underlying mechanisms remain incompletely understood. Methods and Results Through preliminary detection of clinical patient tissues, we have found that ALDH1A1 was a key gene for the prognosis of cancer patients and tumor glycolysis. In vitro experiments and tumor formation in nude mice suggested that targeting ALDH1A1 could inhibit tumor growth. Through further analysis of xenograft tumor models in immune-normal mice and flow cytometry, we found that deficiency in ALDH1A1 could promote immune system suppression of tumors in vivo. Specifically, RNA-seq analysis, combined with qPCR and western blot, identified the transcription factor ZBTB7B as downstream of ALDH1A1. The binding sites of the transcription factor ZBTB7B on the LDHA promoter region, which is responsible for regulating the rate-limiting enzyme gene LDHA in glycolysis, were determined using luciferase reporter gene detection and Chip-qPCR, respectively. In addition, the increased SUMOylation of ZBTB7B stabilized its transcriptional activity. Further in vivo and in vitro experiments confirmed that the combination of targeting ALDH1A1 and ZBTB7B with immune checkpoint inhibitors could synergistically inhibit tumors in vivo. Finally, after conducting additional verification of patient tissue and clinical data, we have confirmed the potential translational value of targeting ALDH1A1 and ZBTB7B for tumor immunotherapy. Conclusions These results emphasize the potential translational significance of targeting ALDH1A1 and ZBTB7B in the realm of tumor immunotherapy. The convergence of ALDH1A1 inhibition and immune checkpoint blockade, particularly with PD-L1/PD-1 mAb, presents a compelling avenue for curtailing tumor immune escape.

2024-08-27 | GSE269935 | GEO

Transcription profiling by array of Fanconi Anemia patient (FANCA) EBV cell line transduced with control shRNA or a shRNA targeting p53 and treated with a Mitomycin C (MMC) pulse

Project description:Time point (H0, H24, H72) expression data from an EBV cell line obtained from a Fanconi Anemia patient (FANCA) transduced with a control shRNA (sh Ctrl) (n=3) or a shRNA targeting p53 (sh p53) (n=3) and treated with a brief MMC pulse.

2012-10-23 | E-MTAB-1099 | biostudies-arrayexpress

FGFR3-shRNA induced transcriptional changes in RT112 bladder cancer cells

Project description:Aberrant activation of FGFR3 via overexpression or mutation is a frequent feature of bladder cancer; however, its molecular and cellular consequences and functional relevance to carcinogenesis are not well understood. In this study with a bladder carcinoma cell line expressing inducible FGFR3 shRNAs, we sought to identiy transcriptional targets of FGFR3 and investigate their contribution to bladder cancer development. Bladder cancer cell line RT112 was transduced with a doxycycline-inducible control EGFP shRNA or three independent FGFR3 shRNAs, designated FGFR3 shRNA 2-4, FGFR3 shRNA 4-1 and FGFR3 shRNA 6-16. These four cell lines were treated with or without doxycycline for 48 hr to deplete FGFR3 protein prior to the isolation of mRNA for microarray analysis. Genes that were differentially expressed after doxycycline induction in all three FGFR3-depleted cell lines but not in the control cell line were considered potential FGFR3-regulated genes. Each treatment group was run in triplcates, and there are 24 samples.

2012-11-07 | E-GEOD-41035 | biostudies-arrayexpress

Impact of genetic suppression (shRNA) of ALDH1A1 expression in human colon cancer cell line (COLO320)

Project description:Using a multi-omics approach, we have investigated the impact of genetic suppression (shRNA) of ALDH1A1 expression on transcriptomics, proteomics and untargeted metabolomics analyses in a human colon cancer cell line (COLO320). The present study (i) generates an integrative omic profile of scramble shRNA vs. ALDH1A1 shRNA COLO320 cells, and (ii) identifies possible alterations in biological pathways caused by suppression of ALDH1A1 expression.

2018-11-12 | ST001093 | MetabolomicsWorkbench

Autism patient derived SHANK2BY29X mutation affects ALDH1A1 negative dopamine neuron development

Project description:Autism patient derived SHANK2BY29X mutation affects ALDH1A1 negative dopamine neuron development

| PRJNA1078417 | ENA

Transcriptome expression changes after knockdown of ALDH1A1 in human colon cancer cells HT29

Project description:Firstly, shRNA (GCCAAATCATTCCTTGGAATT) was used to knock down ALDH1A1 in HT29 cells, and the knockdown effect was verified by western blot. Then the shALDH1A1 HT29 cells were compared with parental HT29 cells by RNA-seq.

2024-08-27 | GSE225822 | GEO

MiRnome profiling of Human bladder cancer line invalidated for the MUC4 gene by ShRNA.

Project description:MiRnome profiling of Human bladder cancer line invalidated for the MUC4 gene by ShRNA.

2022-08-29 | GSE137130 | GEO

Microarray of NFAT1-shRNA (KD) vs Non-targeting shRNA (NT) metastatic melanoma cell line

Project description:The metastatic melanoma cell line A375SM was stably transduced with NFAT 1 shRNA utilizing the pSIH-HI- 5 copGFP lentiviral vector. A non-targeting (NT) shRNA construct with no known homology to any human gene was was created and transduced into A375SM cells as a control. These two sets of cells were then subjected to microarray profiling using the Human OneArray microarray (version HOA 6.1, GEO Platform GPL19137) from Phalanx Biotech Group. NFAT shRNA A375SM cells vs. NT-shRNA A375SM cells were subjected to microarray analysis. 3 biological replicates for each cell type were used.

2016-01-06 | E-GEOD-76541 | biostudies-arrayexpress

Inhibition of BET protein BRD4 activity synergizes with cisplatin in ovarian cancer by targeting ALDH activity through an ALDH1A1 super-enhancer and the associated enhancer RNA

Project description:The emergence of tumor cells with certain stem-like characteristics such as high aldehyde dehydrogenase (ALDH) activity contributes to chemotherapy resistance. Here we report that inhibition of the BET protein BRD4 potentiates the tumor suppressive effects of cisplatin by targeting ALDH activity. The clinically applicable small molecule BET inhibitor JQ1 synergized with cisplatin by suppressing the growth of epithelial ovarian cancer cells both in vitro and in vivo. This correlated with the suppression of ALDH activity and ALDH1A1 gene expression. BRD4 regulates ALDH1A1 gene transcription through a super-enhancer and expression of its associated enhancer RNA. Thus, targeting the BET protein BRD4 using clinical applicable small molecule inhibitors such as JQ1 is a promising strategy to enhance cisplatin response.

2017-02-05 | GSE77568 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data