Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

RNAseq & Smad and Foxh1 ChIpseq in pluripotent mESC and EBs

ABSTRACT: RNAseq & Smad and Foxh1 ChIpseq in pluripotent mESC and EBs

PROVIDER: PRJNA515268 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR8444250_1.fastq.gz	Fastqsanger.gz
	SRR8444250_2.fastq.gz	Fastqsanger.gz
	SRR8444260_1.fastq.gz	Fastqsanger.gz
	SRR8444260_2.fastq.gz	Fastqsanger.gz
	SRR8444270_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 50

Similar Datasets

RNAseq & Smad and Foxh1 ChIpseq in pluripotent mESC and EBs

Project description:Smad2, Smad3, Smad4 and Foxh1 ChIPseq performed in pluripotent mESC and embryonic bodies (EBs). RNAseq were performed in WT mESCs and Ebs of WT, Smad2KO, Smad3KO and Smad2/3DKO.

2019-09-05 | GSE125116 | GEO

HEB and E2A function as SMAD/FOXH1 cofactors

Project description:Nodal signaling, mediated through SMAD transcription factors, is necessary for pluripotency maintenance and endoderm commitment. We have identified a new motif, termed SMAD Complex Associated (SCA) that is bound by SMAD2/3/4 and FOXH1 in human embryonic stem cells (hESCs) and derived endoderm. We demonstrate that two bHLH proteins - HEB and E2A - bind the SCA motif at regions overlapping SMAD2/3 and FOXH1. Further, we show that HEB and E2A associate with SMAD2/3 and FOXH1, suggesting they form a complex at critical target regions. This association is biologically important, as E2A is critical for mesendoderm specification, gastrulation, and Nodal signal transduction in Xenopus tropicalis embryos. Taken together, E2A is a novel Nodal signaling cofactor that associates with SMAD2/3 and FOXH1 and is necessary for mesendoderm differentiation. ChIP-seq of Smad2/3 and Input in X.tropicalis, stage 10.5 embryo.

2011-08-23 | E-GEOD-30146 | biostudies-arrayexpress

HEB and E2A function as SMAD/FOXH1 cofactors

2011-08-23 | GSE30146 | GEO

The binding sites of SMAD2/3, Dnmt3a and Dnmt3b in pluripotent mESC, EBs and ME when Smad4 is lost with or without Dnmt3b knockdown

Project description:To understand the genome wide binding profile of SMAD2/3 when SMAD4 is lost, Smad2/3 ChIPseq was performed in SMAD4 knockout (S4KO) mouse embryonic stem cells (mESC) or in S4KO embryonic bodies (EBs). To figure out the effect of Dnmt3b on SMAD2/3 binding ability in the absence of SMAD4, we further performed SMAD2/3 CUT&Tag in EBs of S4KO and S4KO with Dnmt3b konckdown, as well as in mesendoderm (ME) stage of WT and S4KO. The binding sites of Dnmt3a and Dnmt3b were explored by Dnmt3a or Dnmt3b ChIP-seq and Dnmt3b CUT&Tag in WT EBs and S4KO EBs. WT with Dnmt3b knockdown and S4KO with Dnmt3b knockdown were used to as a control for the Dnmt3b CUT&Tag. Besides, we inserted a 3xFlag-tag at the C-terminus of Dnmt3a or Dnmt3b and then carried out Flag CUT&Tag in EBs.

2024-10-21 | GSE240786 | GEO

RNAseq of SMAD2/3DKO and Smad4KO in pluripotent mESC and EBs

Project description:RNAseq of SMAD2/3DKO and Smad4KO in pluripotent mESC and EBs

| PRJNA1005247 | ENA

RNAseq of SMAD2/3DKO and Smad4KO in pluripotent mESC and EBs

Project description:To dissected the roles of SMAD2/3 and SMAD4 in mouse embryonic stem cells (mESC), knockouts of SMAD2/3 (SMAD2 and SMAD3 double knockout, S2/3DKO) and SMAD4 (SMAD4 knockout, S4KO) were used to conduct RNAseq in ES and EB conditions.

2024-10-21 | GSE240785 | GEO

Engagement of Foxh1 in chromatin regulation revealed by protein interactome analyses

Project description:Precise gene expression patterns, both in time and space, is required for developmental processes to properly progress. Early embryonic cell fates are specified through the coordinated integration of transcription factor activities and epigenetic states of the genome. Foxh1 is a key maternal transcription factor controlling the mesendodermal gene regulatory program. Proteomic interactome analyses using FOXH1 as a bait in mouse embryonic stem cells revealed that FOXH1 interacts with PRC2 subunits and Hdac1. Foxh1 physically interacts with Hdac1, and confers transcriptional repression of mesendodermal genes in the ectoderm. Our findings reveal a central role of Foxh1 in coordinating the chromatin states of the Xenopus embryonic genome.

2022-08-04 | GSE204990 | GEO

Identification of differentially-expressed genes between FoxH1 morpholino and control in zebrafish embryos.

Project description:The Forkhead Box H1 (FoxH1) protein is a co-transcription factor recruited by phosphorylated Smad2 downstream of several TGFbetas, including Nodal-related proteins. We have reassessed the function of zebrafish FoxH1 using antisense morpholino oligonucleotides (MOs) ( 5’ TGCTTTGTCATGCTGATGTAGTGGG 3’) as compared with a control morpholino (MO) with no specific target (5’ TAGTTAAGCCTAGCTCTCATAAACT 3’). Probing FoxH1 morphant RNA by microarray, we identified a cohort of five keratin genes – cyt1, cyt2, krt4, krt8 and krt18 - that are normally transcribed in the embryo’s enveloping layer (EVL) and which have significantly reduced expression in FoxH1-depleted embryos. Keywords: 40% epiboly-stage embryos, injected with either 8 ng of a 25mer morpholino (MO) with no specific target or 8 ng of a 25mer MO with reverse complementary to the 5’ untranslated region of the zebrafish foxH1 gene.

2007-07-30 | GSE8076 | GEO

Genome-wide view of TGFb/Foxh1 regulation of the early mesendoderm program [RNA-seq]

Project description:We identified Nodal and Foxh1 downstream targets by performing RNA-seq of embryos either treated with small molecule SB431542 or microinjected morpholino anti-sense oligo against Foxh1.

2014-11-07 | GSE53653 | GEO

Genome-wide analysis of Smad2 and FoxH1 binding sites in zebrafish blastula

Project description:Morphogen gradients expose cells to different signal concentrations and induce target genes with different ranges of expression. To determine how the Nodal morphogen gradient induces distinct gene expression patterns during zebrafish embryogenesis we characterized the binding sites of the Nodal-specific transcription co-activators Smad2 and FoxH1 in wild-type, Nodal-overexpressing or Nodal signaling inhibited embryos. We found that FoxH1 binds to Nodal targets loci even in the absence of the signal, while Smad2 only binds and colocalizes to FoxH1 upon induction of the Nodal pathway.

2015-04-08 | GSE67648 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data