Transcriptomics analysis of gene expression in wildtype and foxo1 synonymous mutated mouse liver
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA517499 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR8497610_1.fastq.gz | Fastqsanger.gz | |||
| SRR8497610_2.fastq.gz | Fastqsanger.gz | |||
| SRR8497611_1.fastq.gz | Fastqsanger.gz | |||
| SRR8497611_2.fastq.gz | Fastqsanger.gz | |||
| SRR8497612_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 8 |
Similar Datasets
Project description:The selected gRNA sequence is tggcatgtttattgagcgctTGG. To disrupt the demethylation motif RRACT in 2288-2290 of Foxo1 mRNA (NM_019739), a mutation (ttGGACT to ctCGATT) target vector was constructed with 1214bp 5’arm and 849bp 3’arm. Mouse zygotes obtained by mating of males with superovulated C57BL/6J females, were injected with a mixture of Cas9 mRNA (80 ng/μl), sgRNA (40 ng/ul) and Donor vector (8 ng/ul). Microinjections were performed into the male pronucleus of fertilized oocytes. Injected zygotes were transferred into pseudopregnant CD1 female mice, and viable adult mice were obtained. Mice were genotyped using sequencing and PCR. PCR primers: mut-F1, ATCCCCATTGAGCAGTAAGTTTTCCA; mut-R1, TGATGGACTCCATGTCACAATCGAG; mut-F2, GCATGTTTATTGAGCGCCTCGAT; mut-R2, CCGCTGTTGCCAAGTCTGAGG; wt-R1, TGATGGACTCCATGTCACAGTCCAA. PCR genotyping of wild-type (wt) and mutant (mut) mice was using primers mut-F1 and mut-R1 to generate fragments of 1291 bp for mut allele, using primers mut-F2 and mut-R2 to generate fragments of 930 bp for mut allele, and using primers mut-F1 and wt-R1 to generate fragments of 1291 bp for wt allele. Total RNA was isolated from Liver Tissue using the TRIzol (Invitrogen) reagent by following the company manual. For all samples the RNA integrity was checked using an Agilent Bioanalyzer 2100. Approximately 2.5 µg of total RNA was then used for library preparation using a TruSeq™ RNA Sample Prep Kit v2 (Illumina, San Diego, CA, USA) according to the manufacturer’s protocol.The libraries were sequenced using HiSeq3000 (Illumina) in paired-read mode, creating reads with a length of 101 bp. Sequencing chemistry v2 (Illumina) was used.
2022-01-26 | GSE125786 | GEO
Project description:Transcriptome analysis by RNAseq of human CD34+ hematopoietic stem and progenitor cells transduced with empty vector control(MIT), AML1-ETO (AE), wildtype FOXO1 (F WT) or FOXO1 DNA binding deficient mutant (F DB). We find wildtype FOXO1 partially recapitulates gene signature of AML1-ETO
2017-12-15 | GSE81084 | GEO
Project description:Foxo1 is required for proper developmental progression due to distinct functions at different stages of B cell development, but specific gene targets in pro-B cells are not identified. We performed a microarray analysis in v-Abl transformed pro-B cells to compare the gene expression pattern between wildtype and Foxo1 knockout cells. Foxo1f/f-ERCre vAbl transformed pro-B cells were treated with Tamoxifen to delete floxed alleles for 2 days.
2013-04-13 | E-GEOD-46031 | biostudies-arrayexpress
Project description:Foxo1 is required for proper developmental progression due to distinct functions at different stages of B cell development, but specific gene targets in pro-B cells are not identified. We performed a microarray analysis in v-Abl transformed pro-B cells to compare the gene expression pattern between wildtype and Foxo1 knockout cells.
2013-04-13 | GSE46031 | GEO
Project description:FOXO1, a member of the FOXO forkhead type transcription factors, is markedly up-regulated in skeletal muscle during atrophy. Previously, we created transgenic mice specifically overexpressing FOXO1 in skeletal muscle (FOXO1 Tg mice). These mice weighed less than the wildtype control mice, had a reduced skeletal muscle mass. In this study, to better understand changes in skeletal muscle during atrophy, we performed a microarray analysis of skeletal muscle in wild-type control and FOXO1 Tg mice. The microarray data shows that in the skeletal muscles of FOXO1 Tg mice, gene expression of PGC-1β, a transcriptional regulator whose increased expression activates energy-expenditure-related genes in skeletal muscles, is decreased.
2020-07-07 | GSE146919 | GEO
Project description:Tight regulation of Toll-like receptor (TLR)-mediated inflammatory responses is important in innate immunity. Here, we show that T cell death-associated gene 51 (TDAG51/PHLDA1) is a novel coactivator of the transcription factor FoxO1, regulating inflammatory mediator production in the lipopolysaccharide (LPS)-induced inflammatory response. TDAG51 induction by LPS stimulation was mediated by the TLR2/4 signaling pathway in bone marrow-derived macrophages (BMMs). LPS-induced inflammatory mediator production was significantly decreased in TDAG51-deficient BMMs. In TDAG51-deficient mice, LPS- or pathogenic Escherichia coli infection-induced lethal shock was reduced by decreasing serum proinflammatory cytokine levels. The recruitment of 14-3-3 to FoxO1 was competitively inhibited by the TDAG51-FoxO1 interaction, leading to blockade of FoxO1 cytoplasmic translocation and thereby strengthening FoxO1 nuclear accumulation. TDAG51/FoxO1 double-deficient BMMs showed significantly reduced inflammatory mediator production compared with TDAG51- or FoxO1-deficient BMMs. TDAG51/FoxO1 double deficiency protected mice against LPS- or pathogenic E. coli infection-induced lethal shock by weakening the systemic inflammatory response. Thus, these results indicate that TDAG51 acts as a coactivator of the transcription factor FoxO1, leading to strengthened FoxO1 activity in the LPS-induced inflammatory response.
2023-06-24 | PXD039815 | Pride
Project description:Synonymous mutations do not change the sequence of the polypeptide but they may still influence fitness. We investigated in Salmonella enterica how four synonymous mutations in the rpsT gene (encoding ribosomal protein S20) reduce fitness (i.e. growth rate) and the mechanisms by which this cost can be genetically compensated. The reduced growth rates of the synonymous mutants were correlated with reduced levels of the rpsT transcript and S20 protein. In an adaptive evolution experiment these fitness impairments could be compensated by mutations that either caused up-regulation of S20 through increased gene dosage (due to duplications), increased transcription of the rpsT gene (due to an rpoD mutation or mutations in rpsT), or increased translation from the rpsT transcript (due to rpsT mutations). We suggest that the reduced levels of S20 in the synonymous mutants result in production of a defective subpopulation of 30S subunits lacking S20 that reduce protein synthesis and bacterial growth and that the compensatory mutations restore S20 levels and the number of functional ribosomes. Our results demonstrate how specific synonymous mutations can cause substantial fitness reductions and that many different types intra- and extragenic compensatory mutations can efficiently restore fitness. Furthermore, our study highlights that also synonymous sites can be under strong selection, which may have implications for the use of dN/dS ratios as signature for selection.
2016-03-11 | PXD003495 | Pride
Project description:PAX3-FOXO1 is a fusion transcription factor that is the main driver of tumorigenesis leading to the development of alveolar rhabdomyosarcoma (aRMS). Since aRMS cells are addicted to PAX3-FOXO1 activity, the fusion protein also represents a major target for therapeutic interference, which is however challenging as transcription factors usually cannot be inhibited directly by small molecules. Hence, characterization of the biology of PAX3-FOXO1 might lead to the discovery of new possibilities for an indirect inhibition of its activity. Here, our goal was to characterize the proteomic neighborhood of PAX3-FOXO1 and to find candidates potentially affecting its activity and tumor cell viability. Towards this aim, we expressed BirA fused versions of PAX3-FOXO1 (N- and C-terminal) in HEK293T cells under presence of biotin. In the control setup, we expressed the BirA enzyme alone. After Streptavidin purification of biotinylated proteins, we performed mass spectrometry and quantified relative abundances compared to control conditions. This enabled us to determine PAX3-FOXO1 proximal proteins, which we investigated further in orthogonal endogenous systems.
2021-09-16 | PXD022187 | Pride
Project description:Transcriptional dysregulation is a hallmark of diffuse large B-cell lymphoma (DLBCL), as multiple transcriptional regulators are mutated. However, our mechanistic understanding of how normal transcriptional programs are co-opted in DLBCL has been hindered by a lack of methodologies that provide the temporal resolution required to separate direct and indirect effects in transcriptional control. Here, we applied a chemical-genetic approach to engineer the inducible degradation of the transcription factor FOXO1, which is recurrently mutated in DLBCL. The combination of rapid degradation of FOXO1, nascent transcript detection, and accessible chromatin allowed us to identify the direct targets of FOXO1. FOXO1 degradation impaired RNA polymerase pause-release at many target genes. Furthermore, FOXO1 was required to maintain accessibility at specific enhancers associated with target genes. Importantly, many direct targets of FOXO1 were oncogenes including several effectors of the PI3K pathway, which creates a dependency on AKT signaling.
2024-03-25 | GSE243498 | GEO
Project description:Transcriptional dysregulation is a hallmark of diffuse large B-cell lymphoma (DLBCL), as multiple transcriptional regulators are mutated. However, our mechanistic understanding of how normal transcriptional programs are co-opted in DLBCL has been hindered by a lack of methodologies that provide the temporal resolution required to separate direct and indirect effects in transcriptional control. Here, we applied a chemical-genetic approach to engineer the inducible degradation of the transcription factor FOXO1, which is recurrently mutated in DLBCL. The combination of rapid degradation of FOXO1, nascent transcript detection, and accessible chromatin allowed us to identify the direct targets of FOXO1. FOXO1 degradation impaired RNA polymerase pause-release at many target genes. Furthermore, FOXO1 was required to maintain accessibility at specific enhancers associated with target genes. Importantly, many direct targets of FOXO1 were oncogenes including several effectors of the PI3K pathway, which creates a dependency on AKT signaling.
2024-03-25 | GSE243496 | GEO