Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: 16s rDNA miseq

PROVIDER: PRJNA527123 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR8733690_1.fastq.gz	Fastqsanger.gz
	SRR8733690_2.fastq.gz	Fastqsanger.gz
	SRR8733700_1.fastq.gz	Fastqsanger.gz
	SRR8733700_2.fastq.gz	Fastqsanger.gz
	SRR8733691_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 32

Similar Datasets

Evaluating the gut microbiota shifts caused by two diets based on ancient grains

Project description:Total DNA was extracted from stool specimens, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2022-08-24 | GSE206807 | GEO

680276f5-c47b-4b21-8fc2-20821bb16271 - samples

Project description:Bacterial 16S V4 rDNA was amplified using two differently barcoded V4 fusion primers. Pooled PCR samples were purified and paired-end sequenced on MiSeq instrument for 250 cycles. The steps from DNA quantification to sequencing were conducted at Second Genome Inc.

| EGAD00001005482 | EGA

Project description:Illumina MiSeq paired end sequencing of 16S rDNA

| PRJNA830656 | ENA

Comparing the microbiota composition between Cocaine addicted and Healthy subjects and the corresponding shift caused by rTMS treatment.

Project description:Total DNA was extracted from saliva and stool of the patients, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2023-05-31 | GSE206765 | GEO

Microbial community structure of a lotic aquatic system receiving wastewater effluent

Project description:Total bacterial DNA was isolated from water and sediment samples from a local watershed and 16S rRNA sequences were analyzed using the Illumina MiSeq v3 platform in order to generate snapshots of bacterial community profiles.

2016-01-01 | GSE73842 | GEO

Analysis of microbiota composition within breast tumor and healthy breast tissues in males and females

Project description:Total DNA was extracted from FFPE specimens of breast tumor and surrounding healthy tissue, amplified to collect amplicons of variable V3–V4 regions of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2023-06-14 | GSE212891 | GEO

Comparing the microbiota composition between HPV positive and negative patients with CRC

Project description:Total DNA was extracted from the stool of the patients, amplified to collect amplicons of variable V3–V4 regions (primers 341F and 805R) of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2023-10-15 | GSE216589 | GEO

Azithromycin effects on lung microbiome in COPD patient

Project description:Azithromycin (AZM) reduces pulmonary inflammation and exacerbations in chronic obstructive pulmonary disease patients with emphysema. The antimicrobial effects of AZM on the lung microbiome are not known and may contribute to its beneficial effects. Methods. Twenty smokers with emphysema were randomized to receive AZM 250 mg or placebo daily for 8 weeks. Bronchoalveolar lavage (BAL) was performed at baseline and after treatment. Measurements included: rDNA gene quantity and sequence. Results. Compared with placebo, AZM did not alter bacterial burden but reduced Î±-diversity, decreasing 11 low abundance taxa, none of which are classical pulmonary pathogens. Conclusions. AZM treatment the lung microbiome Randomized trial comparing azithromycin (AZM) treatment with placebo for eight weeks. Bronchoalveolar lavage (BAL) samples were obtained before and after treatment to explore the effects of AZM on microbiome, in the lower airways. 16S rRNA was quantified and sequenced (MiSeq) The amplicons from total 39 samples are barcoded and the barcode is provided in the metadata_complete.txt file.

2016-07-19 | E-GEOD-74396 | biostudies-arrayexpress

High-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.

2022-04-02 | GSE199749 | GEO

ena-DATASET-KULVIB-04-03-2016-10:53:34:991-129 - samples

Project description:Firs 1106 16S rDNA data for the Flemish Gut Flora Project

| EGAD00001001936 | EGA