Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

680276f5-c47b-4b21-8fc2-20821bb16271 - samples

ABSTRACT: Bacterial 16S V4 rDNA was amplified using two differently barcoded V4 fusion primers. Pooled PCR samples were purified and paired-end sequenced on MiSeq instrument for 250 cycles. The steps from DNA quantification to sequencing were conducted at Second Genome Inc.

PROVIDER: EGAD00001005482 | EGA |

REPOSITORIES: EGA

ACCESS DATA

Json Xml

Similar Datasets

Comparing the microbiota composition between HPV positive and negative patients with CRC

Project description:Total DNA was extracted from the stool of the patients, amplified to collect amplicons of variable V3–V4 regions (primers 341F and 805R) of the bacterial 16s rRNA gene and sequenced with MiSeq (2x300bp) Illumina platform.

2023-10-15 | GSE216589 | GEO

Genome-wide contacts of rDNA units detected by 4C procedure in human genome [new]

Project description:4C-rDNA procedure was used for analysis of genomic contacts of rDNA units in HEK 293T cells. The primers for PCR amplification were selected upstream from EcoRI site (coordinate 30487 in the sequence with Accession number U13369.1): 5' TTCGCCTACGGATTTCTAGAAAATAA 3' and 5' AAAAGAAGCTCAAGTACATCTAATCTAA 3' (new primers).

2022-12-01 | GSE121363 | GEO

Genome-wide contacts of rDNA units detected by 4C procedure in human genome [hESM01]

Project description:4C-rDNA procedure was used for analysis of genomic contacts of rDNA units in hESM01 cells. The primers for 4C were selected downstream from EcoRI site at coordinate 30487 in rDNA sequence with Accession number U13369.1.

2021-08-11 | GSE175909 | GEO

Azithromycin effects on lung microbiome in COPD patient

Project description:Azithromycin (AZM) reduces pulmonary inflammation and exacerbations in chronic obstructive pulmonary disease patients with emphysema. The antimicrobial effects of AZM on the lung microbiome are not known and may contribute to its beneficial effects. Methods. Twenty smokers with emphysema were randomized to receive AZM 250 mg or placebo daily for 8 weeks. Bronchoalveolar lavage (BAL) was performed at baseline and after treatment. Measurements included: rDNA gene quantity and sequence. Results. Compared with placebo, AZM did not alter bacterial burden but reduced Î±-diversity, decreasing 11 low abundance taxa, none of which are classical pulmonary pathogens. Conclusions. AZM treatment the lung microbiome Randomized trial comparing azithromycin (AZM) treatment with placebo for eight weeks. Bronchoalveolar lavage (BAL) samples were obtained before and after treatment to explore the effects of AZM on microbiome, in the lower airways. 16S rRNA was quantified and sequenced (MiSeq) The amplicons from total 39 samples are barcoded and the barcode is provided in the metadata_complete.txt file.

2016-07-19 | E-GEOD-74396 | biostudies-arrayexpress

Generation of Hematopoietic TF-rDNA Atlas in Human and Mouse

Project description:Over 2000 publicly accessible human and mouse ChIP-Seq datasets for about 250 Transcription Factors and chromatin complexes from various databases (ENCODE, GEO) were mapped to custom-made human and mouse genomes containing a reference rDNA sequence of the appropriate species (Genbank U13369.1 for human, BK000964.3 for mouse). The read mapping density across the rDNA sequence was then extracted and normalized to the median in that dataset. Unbiased clustering and analysis, followed by curation, was performed to identify high-confidence patterns of rDNA occupancy for numerous hematopoietic TFs and TF families at canonical TF motif sequences. ************************ Data processing steps: FASTQs were trimmed using Trimmomatic with the following parameters: LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:30 Reads were mapped to customized genomes (containing additional rDNA sequence) using Bowtie2 using the following parameter: -X 2000 Read density across the rDNA sequence was extracted using igvtools ************************

2022-01-15 | GSE191272 | GEO

Genome-wide contacts of rDNA units detected by 4C procedure in human genome [old]

Project description:4C-rDNA procedure was used for analysis of genomic contacts of rDNA units in HEK 293T cells. The primers for 4C were selected downstream from EcoRI site at coordinate 30487 in rDNA sequence with Accession number U13369.1.

2019-12-03 | GSE121413 | GEO

Hot spots of DNA double-strand breaks and genomic contacts of human rDNA units are involved in epigenetic regulation [rDNA units]

Project description:4C procedure was used for analysis of genomic contacts of rDNA units in HEK 293T cells. The primers for 4C were selected inside IGS. Our data indicate that mostly rDNA units exhibit close proximity with pericentromeric regions in different chromosomes. We also detected the contacts within a rDNA unit and between rDNA units.

2014-10-04 | GSE49193 | GEO

Genome-wide contacts of rDNA units detected by 4C procedure in human genome [old.hs]

Project description:4C procedure was used for analysis of genomic contacts of rDNA units in HEK 293T cells. The primers for 4C were selected downstream from EcoRI site at coordinate 30487 in rDNA sequence with Accession number U13369.1.

2019-12-05 | GSE121417 | GEO

Hot spots of DNA double-strand breaks and genomic contacts of human rDNA units are involved in epigenetic regulation [rDNA units]

2014-10-04 | E-GEOD-49193 | biostudies-arrayexpress

Project description:Artic Primers v4 vs v4.1

| PRJNA902683 | ENA