Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: 16S rRNA amplicon sequencing of human fecal samples

PROVIDER: PRJNA541572 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR9025610_1.fastq.gz	Fastqsanger.gz
	SRR9025610_2.fastq.gz	Fastqsanger.gz
	SRR9025620_1.fastq.gz	Fastqsanger.gz
	SRR9025620_2.fastq.gz	Fastqsanger.gz
	SRR9025630_1.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 184

Similar Datasets

Chronic Strongyloides stercoralis infection increases Ruminococcus torques group and alter microbiome proteome in ivermectin treatment

Project description:The impact of mono-chronic S. stercoralis infection on the gut microbiome and microbial activities in infected participants was explored. The 16S rRNA gene sequencing of a longitudinal study with 2 sets of human fecal was investigated. Set A, 42 samples were matched, and divided equally into positive (Pos) and negative (Neg) for S. stercoralis diagnoses. Set B, 20 samples of the same participant in before (Ss+PreT) and after (Ss+PostT) treatment was subjected for 16S rRNA sequences and LC-MS/MS to explore the effect of anti-helminthic treatment on microbiome proteomes.

2023-11-07 | PXD037975 | JPOST Repository

Multiomic Approach to Analyze Infant Gut Microbiota: Experimental and Analytical Method Optimization

Project description:BACKGROUND: The human intestinal microbiome plays a central role in overall health status, especially in early life stages. 16S rRNA amplicon sequencing is used to profile its taxonomic composition; however, multiomic approaches have been proposed as the most accurate methods for study of the complexity of the gut microbiota. In this study, we propose an optimized method for bacterial diversity analysis that we validated and complemented with metabolomics by analyzing fecal samples.METHODS: Forty-eight different analytical combinations regarding (1) 16S rRNA variable region sequencing, (2) a feature selection approach, and (3) taxonomy assignment methods were tested. A total of 18 infant fecal samples grouped depending on the type of feeding were analyzed by the proposed 16S rRNA workflow and by metabolomic analysis.RESULTS: The results showed that the sole use of V4 region sequencing with ASV identification and VSEARCH for taxonomy assignment produced the most accurate results. The application of this workflow showed clear differences between fecal samples according to the type of feeding, which correlated with changes in the fecal metabolic profile.CONCLUSION: A multiomic approach using real fecal samples from 18 infants with different types of feeding demonstrated the effectiveness of the proposed 16S rRNA-amplicon sequencing workflow.

2021-08-18 | MTBLS2942 | MetaboLights

16S rRNA sequencing of fecal samples from Atg16l1 T300A and wildtype littermate mice that were either exposed or not to mainstream cigarette smoking for 6 weeks

Project description:We found that mainstream cigarette smoking (4 cigarettes/day, 5 days/week for 2 weeks using Kentucky Research Cigarettes 3R4F) resulted in >20% decrease in the percentage of normal Paneth cell population in Atg16l1 T300A mice but showed minimal effect in wildtype littermate control mice, indicating that Atg16l1 T300A polymorphism confers sensitivity to cigarette smoking-induced Paneth cell damage. We performed 16S rRNA sequencing to identify potential microbiota changes associated with Paneth cell defect in Atg16l1 T300A mice exposed to cigarette smoking. Female mice were used at 4-5 weeks of age. Cigarette smoking was performed using smoking chamber with the dosage and schedule as described above. The fecal samples from the mice were collected for 16S rRNA sequencing analysis after completing 6 weeks of smoking.

2018-10-31 | E-MTAB-5717 | biostudies-arrayexpress

Impact of fecal microbiota transplantation (FMT) in 3 days-ABX-treated recipient mice using feces from 6 NSCLC patients at diagnosis.

Project description:This study aimed to analyze changes in gut microbiota composition in mice after transplantation of fecal microbiota (FMT, N = 6) from the feces of NSCLC patients by analyzing fecal content using 16S rRNA sequencing, 10 days after transplantation. Specific-pathogen-free (SPF) mice were used for each experiments (N=4) as controls.

2023-07-01 | E-MTAB-12812 | biostudies-arrayexpress

human gut metagenome

Project description:Fecal samples human Amplicon-Sequencing 16S

| PRJNA209298 | ENA

Gut microbiota analysis of colitic SD rats

Project description:Fecal samples collected on day 5 from randomly selected colitic SD rats were analyzed for gut microbiota by sequencing the V4 region of the 16S rRNA gene. The orally administered Dex-P-laden NPA2 coacervate (Dex-P/NPA2) significantly restores the diversity of gut microbiota compared with colitic SD rats in the Dex-P/PBS group and the untreated colitic rats (Control).

2021-11-06 | GSE167138 | GEO

a7bcbc51-217a-491f-808b-617da8eeca65 - samples

Project description:Fecal samples Illumina MiSeq 16S rRNA sequencing, V4 hypervariable region

| EGAD00001004106 | EGA

Study of Gut Microbiome and Colorectal Tumors

Project description:Gut microbiota were assessed in 540 colonoscopy-screened adults by 16S rRNA gene sequencing of stool samples. Investigators compared gut microbiota diversity, overall composition, and normalized taxon abundance among these groups.

| 2255499 | ecrin-mdr-crc

Gut microbiota composition after 12 weeks of home based lifestyle intervention in breast cancer survivors (MOVIS)

Project description:Analysis of breast cancer survivors' gut microbiota after lifestyle intervention, during the COVID-19 lockdown, by 16S sequencing of fecal samples.

2023-01-13 | E-MTAB-12486 | biostudies-arrayexpress

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data