Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ABSTRACT: Single Primer Enrichment Technology (SPET) for high-throughput genotyping in tomato

PROVIDER: PRJNA542237 | ENA |

REPOSITORIES: ENA

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
	SRR9039490.fastq.gz	Fastqsanger.gz
	SRR9039500.fastq.gz	Fastqsanger.gz
	SRR9039510.fastq.gz	Fastqsanger.gz
	SRR9039520.fastq.gz	Fastqsanger.gz
	SRR9039530.fastq.gz	Fastqsanger.gz

Items per page:

1 - 5 of 400

Similar Datasets

Project description:Single Primer Enrichment Technology (SPET) for high-throughput genotyping in eggplant

| PRJNA542231 | ENA

MAGIC-maize genotyping

Project description:MAGIC-maize population: Single Primer Enrichment Technology genotyping

| PRJEB67515 | ENA

SPET genotyping of NORFAB faba bean panel

Project description:Targeted genotyping of 197 faba bean (Vicia faba L.) accessions using Single primer enrichment technology (SPET).

| PRJEB56010 | ENA

Project description:Genetic dissection of fruit maturity date in apricot (P. armeniaca L.) through a Single Primer Enrichment Technology (SPET) approach

| PRJNA821640 | ENA

Zea mays

Project description:Single primer enrichment technology as a tool for massive genotyping: bridging the gap between arrays and genotyping-by-sequencing

| PRJNA484339 | ENA

Characterization of a large dataset of SNPs in Larimichthys polyactis using high throughput 2b-RAD sequencing

Project description:Single nucleotide polymorphism (SNP) characterization and genotyping of Larimichthys polyactis by using high-throughput 2b-RAD sequencing technology

2020-02-26 | PRJEB36912 | EVA

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

High-throughput single-cell transcriptome profiling of tomato leaf

Project description:High-throughput single-cell transcriptome profiling of tomato leaf

| PRJNA833659 | ENA

Genome-wide maps of the total and lysine methylated enriched pools of peroxisome proliferating activated receptor gamma (pparg) co-activator 1 alpha (ppargc1a) in Hepa 1-6 cells

Project description:We report the application of single nucleotide sequencing technology for high-throughput profiling of ppargc1a in mouse hepatome cells (Hepa1-6). By obtaining 1.2 billion bases of sequence from chromatin immunoprecipitated DNA, we generated genome-wide maps of ppargc1a sin mouse hepatoma cells. We identify novel non- coding sites of ppargc1a occupation in hepatic cells for Sirt5, Idh3b, Pfkl, and Hmox2 strongly corresponds with the enrichment of enhancer -associated RNAs. Examination of the genomic disttribution of the total pool of ppargc1a and the lysine methylated (K779me) enriched pool of ppargc1a in mouse Hepa1-6 hepatoma cells.

2017-05-01 | E-GEOD-57852 | biostudies-arrayexpress

undefined

Project description:G2P-SOL project: SPET genotyping of eggplant

| PRJEB50686 | ENA