Ontology highlight
ABSTRACT:
PROVIDER: PRJNA548337 | ENA |
REPOSITORIES: ENA
Similar Datasets
Project description:Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage
| PRJNA316460 | ENA
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage.
2015-03-04 | GSE61099 | GEO
Project description:We report the PAMs of diverse type I-E CRISPR- Cas systems and the type I-C and the type I-F1 CRISPR-Cas systems from Xanthomonas albilineans. Furthermore, we report PAMs of two type I-B CRISPR transposons (CASTs) and the Vibrio cholerae type I-F CAST. For identification of the PAMs, we used a cell-free TXTL-based PAM screen we named PAM-DETECT. By adding a 5N randomized PAM library and plasmids encoding for Cascade genes and gRNAs, recognized PAMs were bound by Cascade and protected from cleavage by a restriction enzyme that has it's recognition site within the target region. By amplifying the non-cleaved target plasmid, we used next-generation sequencing to analyze the enrichment of functional PAMs of the studied CRISPR-Cas systems. We additionally assessed the insertion sites of crRNA-dependent and crRNA-independent transposition of the Rippkaea orientalis type I-B CAST in TXTL and E. coli.
2022-02-24 | GSE179614 | GEO
Project description:This study investigates the RNA targets and cleavage sites of endogenous Cas9 in the food-borne pathogen Campylobacter jejuni. Direct RNA binding targets of Cas9 in C. jejuni strain NCTC11168 were determined using RIP-seq. The Cleavage sites were then predicted in the RNA targets by comparing total transcriptome data from WT and deletion (cas9, crRNA3, tracrRNA, CRISPR-tracrRNA) strains. PAMs for the CjeCas9 were enriched using the PAM-SCANR platform, which operates through a GFP reporter gene. Upon GFP (and thus functional PAM) enrichment, fluorescing cells were isolated using FACS and prepared plasmid DNA was amplified and prepared for sequencing.
2018-03-01 | GSE106849 | GEO
Project description:Genome editing typically involves recombination between donor nucleic acids and genomic sequences subjected to double-stranded DNA breaks (DSBs) made by programmable nucleases (e.g. CRISPR-Cas9). Yet, amongst other deleterious by-products, DSBs yield translocations, off-target mutations and, most pervasively, unpredictable on-target allelic disruptions. Remarkably, hitherto, the untoward phenotypic consequences of on-target disruptions at allelic and non-allelic (e.g. pseudogene) sequences have received scant scrutiny and, crucially, remain to be addressed. Here, we demonstrate that gene-edited cells can lose fitness due to on-target DSBs and report that simultaneous single-stranded DNA break formation at donor and target DNA by CRISPR-Cas9 “nickases” overcomes, to a great extent, such genotype-phenotype disrupting events. Moreover, in trans paired nicking gene editing can efficiently and precisely add large DNA segments (i.e. live-cell reporter tags) into essential and multiple-copy genomic sequences while circumventing most of the allelic and non-allelic collateral mutations and chromosomal rearrangements characteristic of nuclease-dependent gene editing procedures.
2019-12-04 | GSE135064 | GEO
Project description:CRISPR-Cas transcriptional tools have been widely applied for programmable regulation of complex biological networks. In comparison to eukaryotic systems, bacterial CRISPR activation (CRISPRa) has stringent target site requirements for effective gene activation. While genes may not always have an NGG protospacer adjacent motif (PAM) at the appropriate position, PAM-flexible dCas9 variants can expand the range of targetable sites. Here we systematically evaluate a panel of PAM-flexible dCas9 variants for their ability to activate bacterial genes. We observe that dxCas9-NG provides a high dynamic range of gene activation for sites with NGN PAMs while dSpRY permits modest activity across almost any PAM. Similar trends were observed for heterologous and endogenous promoters. For all variants tested, improved PAM-flexibility comes with the tradeoff that CRISPRi-mediated gene repression becomes less effective. Weaker CRISPR interference (CRISPRi) gene repression can be partially rescued by expressing multiple sgRNAs to target many sites in the gene of interest. Our work provides a framework to choose the most effective dCas9 variant for a given set of gene targets, which will further expand the utility of CRISPRa/i gene regulation in bacterial systems.
2022-11-15 | GSE217559 | GEO