Direct RNA sequencing enables single-nucleotide m6A detection in endogenous transcript isoforms
Ontology highlight
ABSTRACT:
PROVIDER: PRJNA549597 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR9646141_1.fastq.gz | Fastqsanger.gz | |||
| SRR9646142_1.fastq.gz | Fastqsanger.gz | |||
| SRR9646143_1.fastq.gz | Fastqsanger.gz | |||
| SRR9646144_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 4 of 4 |
Similar Datasets
Project description:We report the direct RNA sequencing of HEK293 and a primary human mammary epithelial cell (HMEC) line using Oxford Nanopore based sequencing. Using this data, we built an algorithm to detect m6A modifications within the DRACH motif context. Evaluation of m6A sites was carried out with HEK METTL3 knockdown and HMEC ALKBH5 over expression cell lines.
2020-01-14 | GSE132971 | GEO
Project description:Direct RNA sequencing holds great promise for the de novo identification of RNA modifications at single-coordinate resolution; however, interpretation of raw sequencing output to discover modified bases remains a challenge. Using Oxford Nanopore's direct RNA sequencing technology, we developed a random forest classifier trained using experimentally detected N6-methyladenosine (m6A) sites within DRACH motifs. Our software MINES (m6A Identification using Nanopore Sequencing) assigned m6A methylation status to more than 13,000 previously unannotated DRACH sites in endogenous HEK293T transcripts and identified more than 40,000 sites with isoform-level resolution in a human mammary epithelial cell line. These sites displayed sensitivity to the m6A writer, METTL3, and eraser, ALKBH5, respectively. MINES (https://github.com/YeoLab/MINES.git) enables m6A annotation at single coordinate-level resolution from direct RNA nanopore sequencing.
| S-EPMC6913132 | biostudies-literature
Project description:NET-prism enables RNA polymerase-dedicated transcriptional interrogation at nucleotide resolution
| PRJNA419477 | ENA
Project description:Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5′ and 3′ untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5′ untranslated regions exert robust translational control between cell lines, while 3′ untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels.
2016-01-11 | GSE69352 | GEO
Project description:Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5â?² and 3â?² untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5â?² untranslated regions exert robust translational control between cell lines, while 3â?² untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels. Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).
2016-01-11 | E-GEOD-69352 | biostudies-arrayexpress
Project description:Alternative splicing generates differing RNA isoforms that govern phenotypic complexity of eukaryotes. Its malfunction underlies many diseases, including cancer and cardiovascular diseases. Comparative analysis of RNA isoforms at the genome-wide scale has been difficult. Here, we established an experimental and computational pipeline that accurately quantifies transcript isoforms in their entire length from cDNA sequences with a full-length isoform detection accuracy of 97.6%. We generated a searchable, quantitative human transcriptome annotation with 31,025 known and 5,740 novel transcript isoforms (http://steinmetzlab.embl.de/iBrowser/). By analyzing the isoforms in the presence of RNA Binding Motif Protein 20 (RBM20) mutations associated with aggressive dilated cardiomyopathy (DCM), we identified 121 differentially expressed transcript isoforms in 107 cardiac genes. By establishing an isoform-differential expression test, our approach revealed that 11 of these genes displayed no detectable change in overall RNA expression. However, significant differences in the expression of specific isoforms in these genes was observed. These isoform specific effects demonstrate the need of analyzing RNA isoform expression levels rather than total gene expression levels.
2021-06-16 | E-MTAB-7334 | biostudies-arrayexpress
Project description:Cellular stress response pathways often require transcription-based activation of gene expression to promote cellular adaptation. However, whether general mechanisms exist for stress-responsive gene down-regulation is less clear. A recently defined gene regulatory mechanism enables both up- and down-regulation of protein levels for distinct gene sets by the same transcription factor (TF) via coordinated induction of canonical mRNAs and long undecoded transcript isoforms (LUTIs). We analyzed deep, parallel gene expression datasets to determine whether this mechanism contributes to the conserved Hac1-driven branch of the unfolded protein response (UPRER). Indeed, we found Hac1-dependent protein down-regulation that accompanied the well-characterized up-regulation of ER-related proteins that typifies UPRER activation. Proteins down-regulated by Hac1-driven LUTIs include those with electron transport chain (ETC) function. Aerobic respiration also appears dampened during the UPRER, and abrogated ETC function improves the fitness of UPRER-activated cells, suggesting functional importance of LUTI regulation during the UPRER. We conclude that the UPRER involves large-scale proteome remodeling, mediated in part by Hac1-induced LUTIs, and that this mechanism enables coordination of up- and down-regulation of gene expression during this stress response.
2018-08-26 | GSE115366 | GEO
Project description:Programmable protein scaffolds that target DNA are invaluable tools for genome engineering and designer control of transcription. RNA manipulation provides broad new opportunities for control, including changes in translation. PUF proteins are an attractive platform for that purpose because they bind specific single-stranded RNA sequences by using short repeated modules, each contributing three amino acids that contact an RNA base. Here, we identified the specificities of natural and designed combinations of those three amino acids, using a large randomized RNA library. The resulting specificity code reveals the RNA binding preferences of natural proteins and enables the design of new specificities. Using the code and a translational activation domain, we designed a protein that targets endogenous cyclin B1 mRNA in human cells, increasing sensitivity to chemotherapeutic drugs. Our study provides a guide for rational design of engineered mRNA control, including translational stimulation.
| S-EPMC4125476 | biostudies-literature
Project description:Nonsense-mediated mRNA decay (NMD) is a eukaryotic, translation-dependent degradation pathway that targets mRNAs with premature termination codons and also regulates the expression of some mRNAs that encode full-length proteins. Although many genes express NMD-sensitive transcripts, identifying them based on short-read sequencing data remains a challenge. To identify and analyze endogenous targets of NMD, we applied cDNA Nanopore sequencing and short-read sequencing to human cells with varying expression levels of NMD factors. Our approach detects full-length NMD substrates that are highly unstable and increase in levels or even only appear when NMD is inhibited. Among the many new NMD-targeted isoforms that our analysis identified, most derive from alternative exon usage. The isoform-aware analysis revealed many genes with significant changes in splicing but no significant changes in overall expression levels upon NMD knockdown. NMD-sensitive mRNAs have more exons in the 3΄UTR and for mRNAs with a termination codon in the last exon. The length of the 3΄UTR per se does not correlate with NMD sensitivity. Analysis of splicing signals reveals isoforms where NMD has been co-opted in the regulation of gene expression, but a main function is most likely to rid the transcriptome of isoforms resulting from spurious splicing events. Long-read sequencing enabled the identification of many novel NMD-sensitive mRNAs and revealed both known and unexpected features concerning their biogenesis and their biological role. Our data provide a highly valuable resource of human NMD transcript targets for future genomic and transcriptomic applications.
2021-07-20 | E-MTAB-10452 | biostudies-arrayexpress
Project description:Alternative splicing is a widespread phenomenon in metazoans by which single genes are able to produce multiple isoforms of the gene product. However, this has been poorly characterized in apicomplexans, a major phylum of some of the most important global parasites. Efforts have been hampered by atypical transcriptomic features, such as the high AU content of Plasmodium RNA, but also the limitations of short-read sequencing in deciphering complex splicing events. In this study, we utilized the long read direct RNA sequencing platform developed by Oxford Nanopore Technologies to survey the alternative splicing landscape of Toxoplasma gondii and Plasmodium falciparum We find that while native RNA sequencing has a reduced throughput, it allows us to obtain full-length or nearly full-length transcripts with comparable quantification to Illumina sequencing. By comparing these data with available gene models, we find widespread alternative splicing, particularly intron retention, in these parasites. Most of these transcripts contain premature stop codons, suggesting that in these parasites, alternative splicing represents a pathway to transcriptomic diversity, rather than expanding proteomic diversity. Moreover, alternative splicing rates are comparable between parasites, suggesting a shared splicing machinery, despite notable transcriptomic differences between the parasites. This study highlights a strategy in using long-read sequencing to understand splicing events at the whole-transcript level and has implications in the future interpretation of transcriptome sequencing studies.IMPORTANCE We have used a novel nanopore sequencing technology to directly analyze parasite transcriptomes. The very long reads of this technology reveal the full-length genes of the parasites that cause malaria and toxoplasmosis. Gene transcripts must be processed in a process called splicing before they can be translated to protein. Our analysis reveals that these parasites very frequently only partially process their gene products, in a manner that departs dramatically from their human hosts.
| S-EPMC8561664 | biostudies-literature