Ontology highlight
ABSTRACT:
PROVIDER: PRJNA566051 | ENA |
REPOSITORIES: ENA
Dataset's files
| Action | DRS | |||
|---|---|---|---|---|
| SRR10134903_1.fastq.gz | Fastqsanger.gz | |||
| SRR10134903_2.fastq.gz | Fastqsanger.gz | |||
| SRR10134904_1.fastq.gz | Fastqsanger.gz | |||
| SRR10134904_2.fastq.gz | Fastqsanger.gz | |||
| SRR10134905_1.fastq.gz | Fastqsanger.gz |
Items per page: 5 1 - 5 of 140 |
Similar Datasets
Project description:The experiments were carried out to map the ligand binding landscape of various DNA and RNA duplexed aptamer families. Duplexed Aptamer (DA) constructs were engineered from (i) natural and synthetic DNA and RNA aptamers and (i) synthetic oligonucleotide aptamer-complementary elements synthesized on custom DNA microarrays. The aptamers tested consist of the ATP DNA aptamer, the ATP RNA aptamer, the cocaine DNA aptamer, the human alpha-thrombin DNA aptamer, and the natural add riboswitch aptamer from the pathogenic bacteria Vibrio vulnificus. Each duplexed aptamer family consists of 1000's of synthetic constructs, each formed by hybridizing the aptamer with an aptamer-complementary element (ACE) - here, ACEs consisted of various DNA oligonucleotides synthesized as a custom DNA microarray.
2017-12-20 | E-MTAB-6374 | biostudies-arrayexpress
Project description:The experiments were carried out to map the ligand binding landscape of various DNA and RNA duplexed aptamer families. Duplexed Aptamer (DA) constructs were engineered from (i) natural and synthetic DNA and RNA aptamers and (i) synthetic oligonucleotide aptamer-complementary elements synthesized on custom DNA microarrays. The aptamers tested consist of the ATP DNA aptamer, the ATP RNA aptamer, the cocaine DNA aptamer, the human alpha-thrombin DNA aptamer, and the natural add riboswitch aptamer from the pathogenic bacteria Vibrio vulnificus. Each duplexed aptamer family consists of 1000's of synthetic constructs, each formed by hybridizing the aptamer with an aptamer-complementary element (ACE) - here, ACEs consisted of various DNA oligonucleotides synthesized as a custom DNA microarray.
2017-12-20 | E-MTAB-6377 | biostudies-arrayexpress
Project description:The experiments were carried out to map the ligand binding landscape of various DNA and RNA duplexed aptamer families. Duplexed Aptamer (DA) constructs were engineered from (i) natural and synthetic DNA and RNA aptamers and (i) synthetic oligonucleotide aptamer-complementary elements synthesized on custom DNA microarrays. The aptamers tested consist of the ATP DNA aptamer, the ATP RNA aptamer, the cocaine DNA aptamer, the human alpha-thrombin DNA aptamer, and the natural add riboswitch aptamer from the pathogenic bacteria Vibrio vulnificus. Each duplexed aptamer family consists of 1000's of synthetic constructs, each formed by hybridizing the aptamer with an aptamer-complementary element (ACE) - here, ACEs consisted of various DNA oligonucleotides synthesized as a custom DNA microarray.
2017-12-20 | E-MTAB-6375 | biostudies-arrayexpress
Project description:The experiments were carried out to map the ligand binding landscape of various DNA and RNA duplexed aptamer families. Duplexed Aptamer (DA) constructs were engineered from (i) natural and synthetic DNA and RNA aptamers and (i) synthetic oligonucleotide aptamer-complementary elements synthesized on custom DNA microarrays. The aptamers tested consist of the ATP DNA aptamer, the ATP RNA aptamer, the cocaine DNA aptamer, the human alpha-thrombin DNA aptamer, and the natural add riboswitch aptamer from the pathogenic bacteria Vibrio vulnificus. Each duplexed aptamer family consists of 1000's of synthetic constructs, each formed by hybridizing the aptamer with an aptamer-complementary element (ACE) - here, ACEs consisted of various DNA oligonucleotides synthesized as a custom DNA microarray.
2017-12-20 | E-MTAB-6376 | biostudies-arrayexpress
Project description:The experiments were carried out to map the ligand binding landscape of various DNA and RNA duplexed aptamer families. Duplexed Aptamer (DA) constructs were engineered from (i) natural and synthetic DNA and RNA aptamers and (i) synthetic oligonucleotide aptamer-complementary elements synthesized on custom DNA microarrays. The aptamers tested consist of the ATP DNA aptamer, the ATP RNA aptamer, the cocaine DNA aptamer, the human alpha-thrombin DNA aptamer, and the natural add riboswitch aptamer from the pathogenic bacteria Vibrio vulnificus. Each duplexed aptamer family consists of 1000's of synthetic constructs, each formed by hybridizing the aptamer with an aptamer-complementary element (ACE) - here, ACEs consisted of various DNA oligonucleotides synthesized as a custom DNA microarray.
2017-12-20 | E-MTAB-6378 | biostudies-arrayexpress
Project description:The experiments were carried out to map the ligand binding landscape of various DNA and RNA duplexed aptamer families. Duplexed Aptamer (DA) constructs were engineered from (i) natural and synthetic DNA and RNA aptamers and (i) synthetic oligonucleotide aptamer-complementary elements synthesized on custom DNA microarrays. The aptamers tested consist of the ATP DNA aptamer, the ATP RNA aptamer, the cocaine DNA aptamer, the human alpha-thrombin DNA aptamer, and the natural add riboswitch aptamer from the pathogenic bacteria Vibrio vulnificus. Each duplexed aptamer family consists of 1000's of synthetic constructs, each formed by hybridizing the aptamer with an aptamer-complementary element (ACE) - here, ACEs consisted of various DNA oligonucleotides synthesized as a custom DNA microarray.
2017-12-20 | E-MTAB-6380 | biostudies-arrayexpress
Project description:Raw sequence reads from B. subtilis gcv glycine riboswitch TECprobe-ML libraries
| PRJNA938111 | ENA
Project description:Cancer biomarker discovery constitutes a frontier in cancer research. In recent years, cell-binding aptamers have become useful molecular probes for biomarker discovery. However, there are few successful examples, and the critical barrier resides in the identification of the cell-surface protein targets for the aptamers, where only a limited number of aptamer targets have been identified so far. Herein, we developed a universal SILAC-based quantitative proteomic method for target discovery of cell-binding aptamers. The method allowed for distinguishing specific aptamer-binding proteins from non-specific proteins based on abundance ratios of proteins bound to aptamer-carrying bait and control bait. In addition, we employed fluorescently labeled aptamers for monitoring and optimizing the binding conditions. We were able to identify and validate selectin L and integrin 4 as the protein targets for two previously reported aptamers, Sgc-3b and Sgc-4e, respectively. This strategy should be generally applicable for the discovery of protein targets for other cell-binding aptamers, which will promote the applications of these aptamers.
2022-02-28 | PXD002480 | Pride
Project description:We report high-affinity ssDNA aptamers as biomarkers and antagonists of amyloid-β peptide. We generated three novel aptamer sequences from the pool of aptamers through the SELEX process, and evaluated their affinity and sensitivity using enzyme-linked immunosorbent assay (ELISA). (The forward primer: ATTAGTCAAGAGGTAGACGCACATA, reverse primer TTCTGGTCGTCGTGACTCCTAT) The ssDNA aptamers modeled into a three-dimensional structure; interaction and mechanism of action derived through molecular dynamics simulations (MD). MD simulations revealed the nature of binding and inhibition of aggregation by binding with amyloid-β peptide monomers, dimers, and other oligomers. The presence of high non-bonded interaction energy along with hydrogen bonds constitutes the complex structure of the aptamer-amyloid-β peptide. Furthermore, the changes in the secondary structure induced by aptamers may help remove the peptide through the blood-brain barrier. This study provided a framework for the application of aptamers against amyloid-β peptides as biomarkers and antagonists.
2019-09-30 | GSE124865 | GEO